Incidental Mutation 'R0646:Poglut1'
ID57216
Institutional Source Beutler Lab
Gene Symbol Poglut1
Ensembl Gene ENSMUSG00000034064
Gene Nameprotein O-glucosyltransferase 1
SynonymsRumi, Ktelc1, 9630046K23Rik
MMRRC Submission 038831-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0646 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38525137-38550258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38529475 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 312 (I312N)
Ref Sequence ENSEMBL: ENSMUSP00000038166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036210]
Predicted Effect probably damaging
Transcript: ENSMUST00000036210
AA Change: I312N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038166
Gene: ENSMUSG00000034064
AA Change: I312N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CAP10 121 373 6.69e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153187
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (123/130)
MGI Phenotype FUNCTION: This gene encodes a protein that can catalyze transfer of either UDP-glucose or UDP-xylose to epidermal growth factor (EGF) repeats, such as those found in Notch. Loss of this gene product results in embryonic lethality. Embryos have neural plate defects, heart defects, and truncations of their posterior axis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality during organogenesis, embryonic growth retardation, caudal body truncation, and severe defects in neural tube development, somitogenesis, cardiogenesis, and vascular remodeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik C T 11: 23,575,491 R716H probably damaging Het
4930432E11Rik C T 7: 29,561,285 noncoding transcript Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Abcb11 A G 2: 69,285,283 I579T probably damaging Het
Abcc9 T C 6: 142,682,104 N400S probably benign Het
Adarb2 T C 13: 8,731,819 L577P probably damaging Het
Agt A C 8: 124,557,113 N422K probably damaging Het
Ahnak A T 19: 9,013,402 K4017* probably null Het
Akap13 C A 7: 75,747,746 Q2575K probably damaging Het
Aldh3a2 A T 11: 61,253,715 I339K probably damaging Het
Alox15 G T 11: 70,345,624 Y483* probably null Het
Ampd1 A T 3: 103,099,597 I713F probably damaging Het
Amph A T 13: 19,113,116 E344V possibly damaging Het
Arid5b A G 10: 68,096,977 S1032P probably damaging Het
Armc8 C A 9: 99,505,688 L393F probably damaging Het
Bpnt1 A G 1: 185,345,426 probably null Het
Cachd1 G A 4: 100,988,221 R970H probably damaging Het
Cd207 T C 6: 83,675,756 T131A probably benign Het
Cd83 G A 13: 43,797,533 V54I probably benign Het
Cfap43 T C 19: 47,763,676 K1086E probably benign Het
Cfap65 A T 1: 74,902,169 V1837E probably benign Het
Clcnka T A 4: 141,396,606 H89L probably benign Het
Cnga4 T C 7: 105,404,975 I50T possibly damaging Het
Cog5 A G 12: 31,837,359 probably benign Het
Col11a2 T A 17: 34,059,348 probably null Het
Col28a1 T G 6: 8,175,291 I186L possibly damaging Het
Col4a2 T A 8: 11,431,252 M808K probably benign Het
Copb2 A G 9: 98,563,475 probably benign Het
Dbnl G A 11: 5,795,441 probably benign Het
Dbx2 T C 15: 95,654,612 T51A possibly damaging Het
Dcp1a A T 14: 30,502,885 M123L probably damaging Het
Ddx42 T A 11: 106,232,833 F217I probably benign Het
Dlc1 T C 8: 36,858,051 T367A probably benign Het
Dmgdh A T 13: 93,752,355 T834S probably benign Het
Dnah8 T C 17: 30,684,173 S929P probably damaging Het
Dnase1l2 C A 17: 24,441,082 V271L possibly damaging Het
Dsc1 T C 18: 20,096,057 Y392C probably damaging Het
Edn1 T C 13: 42,305,242 probably benign Het
Eps8l3 T C 3: 107,884,810 L351P probably damaging Het
F12 G A 13: 55,422,483 probably benign Het
Fam47e T C 5: 92,578,458 probably benign Het
Fcrl5 C A 3: 87,442,013 Q32K probably benign Het
Fndc1 C T 17: 7,741,673 V1637I possibly damaging Het
Foxg1 G T 12: 49,384,567 probably benign Het
Frrs1 A T 3: 116,902,421 I530F possibly damaging Het
Galnt5 A T 2: 57,999,085 K232N probably benign Het
Ggt5 G A 10: 75,602,648 V68M probably damaging Het
Gm11639 G A 11: 104,720,501 D390N probably benign Het
Gm13084 A C 4: 143,812,585 S113A possibly damaging Het
Gm16519 T C 17: 70,929,106 C17R probably benign Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gm884 T A 11: 103,613,160 K485* probably null Het
Gm9631 T G 11: 121,945,629 D28A probably damaging Het
Gpx2 T C 12: 76,795,313 I21M probably benign Het
H2-Q2 T G 17: 35,345,685 D354E probably damaging Het
Icam2 A T 11: 106,380,891 I71K probably damaging Het
Il12a T C 3: 68,697,890 probably benign Het
Insm2 C G 12: 55,600,440 A323G probably benign Het
Itga1 T C 13: 114,968,299 T1064A probably benign Het
Itgad T A 7: 128,174,004 V11E possibly damaging Het
Kctd15 C T 7: 34,644,881 S115N probably damaging Het
Klra5 A G 6: 129,903,564 W124R probably damaging Het
Kng2 T A 16: 22,987,736 D571V probably benign Het
Kpna6 A T 4: 129,650,790 F380I probably benign Het
Lipo1 A T 19: 33,784,769 Y109* probably null Het
Man2a2 T C 7: 80,363,197 H540R possibly damaging Het
Map2k4 T C 11: 65,712,275 E188G probably damaging Het
Mast4 T C 13: 102,758,744 probably benign Het
Mbtd1 A G 11: 93,905,212 D25G probably damaging Het
Med13 T A 11: 86,331,089 Q238L possibly damaging Het
Mmachc A G 4: 116,703,654 Y215H probably damaging Het
Mtor T A 4: 148,484,354 Y1110* probably null Het
Nek2 A G 1: 191,822,219 N57D probably damaging Het
Nek7 ACCCC ACCC 1: 138,515,693 probably null Het
Neo1 G T 9: 58,931,034 T489K probably damaging Het
Neu1 T A 17: 34,934,760 Y387N probably damaging Het
Nfasc A T 1: 132,608,438 C586* probably null Het
Nle1 G A 11: 82,904,845 L259F probably damaging Het
Nrde2 G A 12: 100,143,846 Q309* probably null Het
Nufip2 C T 11: 77,686,453 H76Y probably benign Het
Olfr1330 A C 4: 118,893,490 T136P probably damaging Het
Olfr1383 A T 11: 49,524,578 N285I probably damaging Het
Olfr466 A T 13: 65,153,063 I280F probably damaging Het
Olfr584 T C 7: 103,086,151 F206S probably damaging Het
Olfr670 A T 7: 104,959,811 I307N probably benign Het
Olfr731 A T 14: 50,238,639 I82N probably damaging Het
Pcdhb5 A G 18: 37,321,622 T352A probably benign Het
Pcdhb7 A T 18: 37,343,389 D526V probably damaging Het
Phkg1 A T 5: 129,864,553 probably null Het
Plg C T 17: 12,418,736 T744M probably damaging Het
Plxnd1 A C 6: 115,958,699 probably benign Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppt1 A G 4: 122,844,099 M77V probably benign Het
Pramel5 G T 4: 144,271,620 T351N probably damaging Het
Psmb4 G A 3: 94,884,964 R216C probably benign Het
Ptprd T C 4: 76,084,403 T699A probably damaging Het
Retreg3 A T 11: 101,098,629 probably benign Het
Scaper G A 9: 55,758,056 A389V probably damaging Het
Serinc5 G A 13: 92,688,737 D225N possibly damaging Het
Slco1a1 T G 6: 141,925,754 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sod3 A T 5: 52,368,079 D40V probably benign Het
Sorcs3 C A 19: 48,206,295 A39E probably benign Het
Spon1 A T 7: 114,039,821 T761S probably benign Het
Syde2 A G 3: 146,014,249 probably null Het
Synm T A 7: 67,759,168 D154V probably benign Het
Synpo2 T C 3: 123,114,449 E406G probably damaging Het
Tcea3 T A 4: 136,248,071 L8* probably null Het
Tec G A 5: 72,823,497 L33F probably damaging Het
Tex15 T A 8: 33,582,326 S2634T possibly damaging Het
Tg T A 15: 66,729,626 Y162N probably damaging Het
Tmem8b G A 4: 43,690,123 V853I probably benign Het
Togaram1 A G 12: 65,021,466 K1748E probably damaging Het
Ttn T C 2: 76,898,478 probably benign Het
Usp36 C T 11: 118,273,021 D234N probably damaging Het
Usp40 G A 1: 87,978,522 P664S probably benign Het
Vmn1r54 T A 6: 90,269,653 L183H probably benign Het
Vmn1r58 T G 7: 5,410,677 I185L probably benign Het
Wnt8a A T 18: 34,547,565 R328W probably benign Het
Yars A G 4: 129,213,939 probably benign Het
Zbtb49 A C 5: 38,200,674 M745R probably damaging Het
Zeb1 T G 18: 5,759,027 F162V probably damaging Het
Zfp369 A T 13: 65,297,548 H835L probably damaging Het
Zic5 A G 14: 122,463,939 V460A unknown Het
Zp3 A G 5: 135,984,356 N181D possibly damaging Het
Other mutations in Poglut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Poglut1 APN 16 38542916 missense possibly damaging 0.96
R0799:Poglut1 UTSW 16 38534721 splice site probably null
R2025:Poglut1 UTSW 16 38537905 critical splice donor site probably null
R2054:Poglut1 UTSW 16 38534807 missense probably damaging 1.00
R4514:Poglut1 UTSW 16 38549416 missense probably benign 0.00
R4770:Poglut1 UTSW 16 38534757 missense probably damaging 1.00
R5649:Poglut1 UTSW 16 38531811 missense probably damaging 0.99
R5893:Poglut1 UTSW 16 38529595 missense probably damaging 0.99
R6796:Poglut1 UTSW 16 38529610 missense probably damaging 1.00
R7404:Poglut1 UTSW 16 38537922 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGATCAAAGCCTTTTCAGTTCATCAGCA -3'
(R):5'- GAAGGTCCTGTTCTGGTAGCAGC -3'

Sequencing Primer
(F):5'- tgcttctgccttgatgctg -3'
(R):5'- CAAACACCTCTTCTTGTGCG -3'
Posted On2013-07-11