Incidental Mutation 'R7001:Nol6'
ID544531
Institutional Source Beutler Lab
Gene Symbol Nol6
Ensembl Gene ENSMUSG00000028430
Gene Namenucleolar protein family 6 (RNA-associated)
SynonymsNrap
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7001 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41114427-41124455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41121279 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 326 (S326P)
Ref Sequence ENSEMBL: ENSMUSP00000030138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030138]
Predicted Effect probably benign
Transcript: ENSMUST00000030138
AA Change: S326P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030138
Gene: ENSMUSG00000028430
AA Change: S326P

DomainStartEndE-ValueType
Pfam:Nrap 174 1145 5e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleolus is a dense subnuclear membraneless organelle that assembles around clusters of rRNA genes and functions in ribosome biogenesis. This gene encodes a nucleolar RNA-associated protein that is highly conserved between species. RNase treatment of permeabilized cells indicates that the nucleolar localization is RNA dependent. Further studies suggest that the protein is associated with ribosome biogenesis through an interaction with pre-rRNA primary transcripts. Alternative splicing has been observed at this locus and two splice variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,065,511 Q154K probably benign Het
Aldh6a1 T G 12: 84,441,888 T75P probably damaging Het
Ank2 T A 3: 127,077,581 H98L probably damaging Het
Ankib1 A G 5: 3,694,781 F800S probably benign Het
Arhgap10 A T 8: 77,365,088 M434K possibly damaging Het
Cap1 A T 4: 122,864,615 F257L probably benign Het
Cdt1 T A 8: 122,572,510 H510Q probably damaging Het
Clca3b A C 3: 144,827,972 D547E possibly damaging Het
Col24a1 T C 3: 145,298,866 V35A probably benign Het
Cyp2j13 A T 4: 96,056,875 N305K probably damaging Het
D3Ertd751e T A 3: 41,758,409 probably null Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Ddc T C 11: 11,824,870 probably null Het
Dnah12 A T 14: 26,879,724 Y3713F probably damaging Het
Dock8 T A 19: 25,099,677 S504T probably benign Het
Farp2 T C 1: 93,620,184 F941L possibly damaging Het
Farp2 A G 1: 93,620,230 N956S possibly damaging Het
Fbxo3 T A 2: 104,051,224 H300Q probably damaging Het
Fcgrt T C 7: 45,102,042 T131A probably benign Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Frem1 T C 4: 82,986,561 E890G probably benign Het
Fsip2 C A 2: 82,986,925 P4334H probably damaging Het
Gcdh C A 8: 84,890,911 V227L probably benign Het
Gm8267 A C 14: 44,722,928 M120R possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Lasp1 T G 11: 97,806,833 H26Q probably damaging Het
Lrrcc1 T A 3: 14,540,095 I297N probably damaging Het
Map1b A T 13: 99,430,593 N1873K unknown Het
Map2 A G 1: 66,415,487 I1179V probably benign Het
Mtss1 A C 15: 58,948,334 probably benign Het
Mtus2 A G 5: 148,277,628 E28G probably damaging Het
Muc6 G A 7: 141,637,407 T2386I probably damaging Het
Myo3a G T 2: 22,332,377 V362L probably benign Het
N6amt1 G A 16: 87,354,292 V14M probably benign Het
Nav1 A T 1: 135,454,611 probably null Het
Olfr1084 A T 2: 86,639,151 S186T probably benign Het
Olfr599 A G 7: 103,338,221 S56G possibly damaging Het
Olr1 T A 6: 129,488,111 E100V probably damaging Het
Otop3 T C 11: 115,339,653 Y119H probably damaging Het
Prpmp5 C T 6: 132,312,564 G99E unknown Het
Ryr2 A T 13: 11,794,605 M778K probably damaging Het
Serpina3n G T 12: 104,408,925 M85I probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sf3b1 A G 1: 55,001,046 V591A probably damaging Het
Sf3b1 A G 1: 55,014,481 probably null Het
Slc26a5 C T 5: 21,811,336 V646I probably damaging Het
Slitrk3 T A 3: 73,050,609 K277* probably null Het
Sv2c A G 13: 95,981,953 S463P probably benign Het
Tbc1d4 G A 14: 101,458,749 T858M probably benign Het
Tbx18 T A 9: 87,727,404 I193F probably damaging Het
Tm6sf2 A C 8: 70,078,332 D245A probably damaging Het
Unc119 T C 11: 78,348,554 Y234H probably damaging Het
Wrn A T 8: 33,352,129 S46T probably benign Het
Zfp729a A T 13: 67,620,349 I587K probably benign Het
Zfp872 C A 9: 22,200,616 H464N probably damaging Het
Other mutations in Nol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nol6 APN 4 41123374 missense possibly damaging 0.89
IGL00787:Nol6 APN 4 41122198 missense probably benign 0.10
IGL01062:Nol6 APN 4 41118205 missense probably benign 0.13
IGL01113:Nol6 APN 4 41115749 missense probably damaging 1.00
IGL01874:Nol6 APN 4 41115412 missense probably damaging 1.00
IGL01995:Nol6 APN 4 41118567 missense probably damaging 1.00
IGL02060:Nol6 APN 4 41117700 missense probably damaging 1.00
IGL03082:Nol6 APN 4 41115878 splice site probably benign
IGL03221:Nol6 APN 4 41124166 missense probably benign 0.00
IGL03332:Nol6 APN 4 41120735 missense probably damaging 1.00
leaky UTSW 4 41118154 missense probably benign 0.02
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0308:Nol6 UTSW 4 41123584 missense probably benign 0.01
R0632:Nol6 UTSW 4 41121115 missense probably damaging 0.96
R1222:Nol6 UTSW 4 41120760 missense probably benign 0.01
R1471:Nol6 UTSW 4 41120281 missense probably benign 0.00
R1481:Nol6 UTSW 4 41123596 missense probably benign 0.00
R1971:Nol6 UTSW 4 41119542 missense probably damaging 1.00
R2191:Nol6 UTSW 4 41118720 missense probably benign 0.00
R2495:Nol6 UTSW 4 41118427 missense probably damaging 1.00
R3852:Nol6 UTSW 4 41117452 missense probably damaging 0.99
R3923:Nol6 UTSW 4 41121531 missense probably benign 0.17
R4458:Nol6 UTSW 4 41115888 missense probably damaging 1.00
R4510:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4511:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4575:Nol6 UTSW 4 41120299 missense probably benign 0.00
R4637:Nol6 UTSW 4 41121788 missense probably damaging 0.99
R4700:Nol6 UTSW 4 41118944 missense possibly damaging 0.58
R4820:Nol6 UTSW 4 41121508 missense probably damaging 1.00
R4975:Nol6 UTSW 4 41120167 missense probably benign 0.00
R5395:Nol6 UTSW 4 41118392 intron probably benign
R5826:Nol6 UTSW 4 41122158 missense probably benign 0.04
R6531:Nol6 UTSW 4 41118154 missense probably benign 0.02
R6943:Nol6 UTSW 4 41118962 missense probably damaging 1.00
R7035:Nol6 UTSW 4 41118479 missense probably benign 0.01
R7282:Nol6 UTSW 4 41119468 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTAAATCCACCCAGGCCCTG -3'
(R):5'- TGCCAACTAAGAACAATGTGCG -3'

Sequencing Primer
(F):5'- CCCTGAAAGAGAAGCATGACTG -3'
(R):5'- TAAGAACAATGTGCGCTCTGC -3'
Posted On2019-05-13