Incidental Mutation 'R7156:Cc2d1a'
ID557314
Institutional Source Beutler Lab
Gene Symbol Cc2d1a
Ensembl Gene ENSMUSG00000036686
Gene Namecoiled-coil and C2 domain containing 1A
SynonymsFreud-1, Tape
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R7156 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84132828-84147936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84135760 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 684 (V684M)
Ref Sequence ENSEMBL: ENSMUSP00000046449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040383] [ENSMUST00000093380] [ENSMUST00000117424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040383
AA Change: V684M

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046449
Gene: ENSMUSG00000036686
AA Change: V684M

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
DM14 137 194 1.02e-14 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 229 238 N/A INTRINSIC
DM14 250 308 8.7e-23 SMART
DM14 342 400 7.44e-31 SMART
low complexity region 457 478 N/A INTRINSIC
DM14 487 545 4.62e-27 SMART
C2 649 763 5.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093380
SMART Domains Protein: ENSMUSP00000091073
Gene: ENSMUSG00000012889

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 38 71 1.91e0 SMART
LRR 70 89 1.81e2 SMART
LRR 90 115 1.76e-1 SMART
LRR 116 139 1.19e2 SMART
LRR 162 186 1.06e1 SMART
LRR 191 210 5.42e1 SMART
LRR 211 231 1.66e1 SMART
LRR 233 257 3.98e1 SMART
LRR_TYP 258 281 7.9e-4 SMART
LRR 304 328 9.24e1 SMART
LRR_TYP 329 352 4.72e-2 SMART
LRR 375 399 2.61e2 SMART
LRR_TYP 400 423 2.61e-4 SMART
LRR 424 444 3.18e1 SMART
LRR 445 470 3.27e1 SMART
LRR_TYP 471 494 3.63e-3 SMART
LRR 495 515 1.97e1 SMART
LRR 516 541 2.03e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117424
AA Change: V638M

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112556
Gene: ENSMUSG00000036686
AA Change: V638M

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
DM14 205 263 8.7e-23 SMART
DM14 297 355 7.44e-31 SMART
low complexity region 411 432 N/A INTRINSIC
DM14 441 499 4.62e-27 SMART
C2 603 717 5.08e-8 SMART
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that binds to a conserved 14-bp 5'-repressor element and regulates expression of the 5-hydroxytryptamine (serotonin) receptor 1A gene in neuronal cells. The DNA binding and transcriptional repressor activities of the protein are inhibited by calcium. A mutation in this gene results in nonsyndromic mental retardation-3.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal lethality, reduced body weight, hunched posture, respiratory distress, increased sensitivity of neurons to hydrogen peroxide, reduced dendrite length, abnormal brain vasculature and reduced synaptic number and density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,858 I317T possibly damaging Het
4931406P16Rik G T 7: 34,245,708 N582K possibly damaging Het
4931409K22Rik C T 5: 24,552,650 E150K probably benign Het
Acsl5 G A 19: 55,268,828 probably null Het
Ahrr G A 13: 74,229,916 T136I probably damaging Het
AI597479 G A 1: 43,111,101 D124N probably damaging Het
Arap2 G T 5: 62,604,571 A1604D probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cadps2 T C 6: 23,688,956 N118S probably benign Het
Caskin1 T A 17: 24,500,683 probably null Het
Ccdc91 T C 6: 147,534,178 S87P possibly damaging Het
Cdr2l A G 11: 115,390,966 Q99R probably benign Het
Celsr3 T C 9: 108,838,004 L2066P possibly damaging Het
Cep95 A C 11: 106,809,224 L313F possibly damaging Het
Chst10 G A 1: 38,874,007 T63M probably damaging Het
Clrn2 G A 5: 45,453,916 G36R probably damaging Het
Cnn2 T G 10: 79,994,515 Y273* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
D630045J12Rik T C 6: 38,195,029 T735A possibly damaging Het
Disp2 C T 2: 118,791,811 A1008V probably damaging Het
Dmrt3 A G 19: 25,610,953 D52G probably damaging Het
Dmrta1 T G 4: 89,688,463 L52R probably damaging Het
Dmrta2 A G 4: 109,981,988 T311A probably damaging Het
Dnm1 T A 2: 32,340,467 N112Y probably damaging Het
Dysf T C 6: 84,087,876 probably null Het
Ep400 A G 5: 110,685,363 F2034L unknown Het
F12 G A 13: 55,418,497 A494V probably damaging Het
Fbp2 A T 13: 62,841,861 F210L probably benign Het
Fbxo31 T A 8: 121,554,321 Q362L possibly damaging Het
Fkbp4 C T 6: 128,435,824 A95T probably benign Het
Frmd6 T G 12: 70,877,209 C80W probably damaging Het
Fsip2 A G 2: 82,982,741 I3135V probably benign Het
Gm597 A T 1: 28,776,767 M728K possibly damaging Het
Guca2b T A 4: 119,657,690 E34V probably damaging Het
Hdlbp G A 1: 93,413,915 T974I probably damaging Het
Hsdl2 T A 4: 59,617,653 M460K possibly damaging Het
Ift172 C T 5: 31,272,075 V581M probably damaging Het
Ift74 A G 4: 94,660,952 K313R possibly damaging Het
Ints4 T A 7: 97,535,286 probably null Het
Kif21b A C 1: 136,147,824 T230P probably damaging Het
Kit A T 5: 75,615,374 Y272F probably benign Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lce1j T A 3: 92,789,184 S96C unknown Het
Marveld3 T A 8: 109,948,188 D332V probably damaging Het
Matr3 G T 18: 35,572,921 V300F probably damaging Het
Mical1 T A 10: 41,485,257 probably null Het
Mslnl T A 17: 25,743,210 V194E probably benign Het
Mug1 C A 6: 121,880,905 T1119K probably damaging Het
Mug1 C T 6: 121,884,343 P1308S probably damaging Het
Neb C A 2: 52,305,283 probably null Het
Neo1 T A 9: 58,902,923 T1082S probably damaging Het
Nkx6-2 C T 7: 139,582,129 probably null Het
Olfr1065 T A 2: 86,445,308 I225L probably damaging Het
Olfr981 T C 9: 40,023,230 I279T probably benign Het
Orc1 A T 4: 108,595,459 E177V probably benign Het
Parp1 G A 1: 180,599,064 V924I possibly damaging Het
Pax2 A T 19: 44,788,859 I165F probably benign Het
Pnma2 C T 14: 66,916,531 P135S probably benign Het
Ranbp17 A G 11: 33,297,420 I718T probably damaging Het
Rbm25 T A 12: 83,664,191 D359E unknown Het
Rgs3 T C 4: 62,617,126 L194P probably damaging Het
Serpinb6b A G 13: 32,971,615 I104V probably benign Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Smpd1 C T 7: 105,554,486 probably benign Het
Snx17 T A 5: 31,197,348 M318K probably damaging Het
Stard10 G A 7: 101,346,051 D337N probably damaging Het
Tex14 A G 11: 87,484,719 T103A probably damaging Het
Tle1 A G 4: 72,170,716 S97P probably benign Het
Tnfrsf8 T A 4: 145,315,084 M1L unknown Het
Traf3ip2 T C 10: 39,626,177 L107P possibly damaging Het
Trpc7 A T 13: 56,789,766 S626T possibly damaging Het
Ubl7 T A 9: 57,929,756 I350N probably damaging Het
Ubr3 T A 2: 70,021,623 I1878N probably damaging Het
Usp24 G T 4: 106,387,919 probably null Het
Vcan A T 13: 89,689,110 S2772T possibly damaging Het
Vmn2r79 T C 7: 87,037,643 V744A probably damaging Het
Wbp2nl T C 15: 82,305,702 S32P probably damaging Het
Wwc1 A G 11: 35,897,374 probably null Het
Zfp629 C T 7: 127,612,291 W115* probably null Het
Other mutations in Cc2d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Cc2d1a APN 8 84140265 missense possibly damaging 0.87
IGL01126:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01129:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01133:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01135:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01953:Cc2d1a APN 8 84143978 missense probably benign 0.00
IGL02216:Cc2d1a APN 8 84139313 nonsense probably null
IGL03131:Cc2d1a APN 8 84143427 missense probably damaging 1.00
IGL03268:Cc2d1a APN 8 84133525 missense probably damaging 1.00
IGL03401:Cc2d1a APN 8 84134629 missense probably benign 0.00
R0313:Cc2d1a UTSW 8 84136969 missense probably benign 0.38
R0811:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0812:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0893:Cc2d1a UTSW 8 84140839 splice site probably benign
R1440:Cc2d1a UTSW 8 84133975 critical splice donor site probably null
R1625:Cc2d1a UTSW 8 84139372 missense probably damaging 1.00
R2183:Cc2d1a UTSW 8 84140399 missense probably damaging 1.00
R5155:Cc2d1a UTSW 8 84141126 missense probably benign 0.00
R5959:Cc2d1a UTSW 8 84133503 nonsense probably null
R6046:Cc2d1a UTSW 8 84136942 missense possibly damaging 0.81
R6386:Cc2d1a UTSW 8 84138537 missense probably damaging 0.96
R6956:Cc2d1a UTSW 8 84135899 missense probably damaging 1.00
R6992:Cc2d1a UTSW 8 84134913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGATTTCCACTGTGGCCC -3'
(R):5'- GAGCAACAGTGACATGCTCCTG -3'

Sequencing Primer
(F):5'- CCACTGTGGCCCTAGGTTTAG -3'
(R):5'- CCTGTTTATCGTGAAGGGCATCAAC -3'
Posted On2019-06-26