Incidental Mutation 'R0329:Pidd1'
ID65106
Institutional Source Beutler Lab
Gene Symbol Pidd1
Ensembl Gene ENSMUSG00000025507
Gene Namep53 induced death domain protein 1
Synonyms1200011D09Rik, Lrdd, Pidd
MMRRC Submission 038538-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0329 (G1)
Quality Score152
Status Validated
Chromosome7
Chromosomal Location141438113-141444025 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 141439561 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019226] [ENSMUST00000026580] [ENSMUST00000106005] [ENSMUST00000106006] [ENSMUST00000106007] [ENSMUST00000124266] [ENSMUST00000128703] [ENSMUST00000133206] [ENSMUST00000138865] [ENSMUST00000150026] [ENSMUST00000172654] [ENSMUST00000190068] [ENSMUST00000190882] [ENSMUST00000201710] [ENSMUST00000201822] [ENSMUST00000202840]
Predicted Effect probably benign
Transcript: ENSMUST00000019226
SMART Domains Protein: ENSMUSP00000019226
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 8.1e-26 PFAM
Pfam:Mito_carr 99 217 8.6e-19 PFAM
Pfam:Mito_carr 221 310 7.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026580
SMART Domains Protein: ENSMUSP00000026580
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:Peptidase_S68 426 459 3.5e-26 PFAM
Pfam:ZU5 463 551 5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106005
SMART Domains Protein: ENSMUSP00000101627
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Pfam:ZU5 328 422 6.6e-11 PFAM
Pfam:Peptidase_S68 426 458 5.2e-21 PFAM
Pfam:ZU5 463 546 6.5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106006
SMART Domains Protein: ENSMUSP00000101628
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.8e-26 PFAM
Pfam:Mito_carr 99 137 5.6e-8 PFAM
Pfam:Mito_carr 134 216 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106007
SMART Domains Protein: ENSMUSP00000101629
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124266
SMART Domains Protein: ENSMUSP00000122177
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128703
SMART Domains Protein: ENSMUSP00000139487
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
LRR 244 266 3.1e-2 SMART
LRR 267 286 1.3e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132635
Predicted Effect probably benign
Transcript: ENSMUST00000133206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138065
Predicted Effect probably benign
Transcript: ENSMUST00000138865
SMART Domains Protein: ENSMUSP00000120721
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.4e-25 PFAM
Pfam:Mito_carr 99 214 1.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147268
Predicted Effect probably benign
Transcript: ENSMUST00000150026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154949
Predicted Effect probably benign
Transcript: ENSMUST00000172654
SMART Domains Protein: ENSMUSP00000133928
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 1 54 6.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190068
SMART Domains Protein: ENSMUSP00000139957
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190303
Predicted Effect probably benign
Transcript: ENSMUST00000190882
SMART Domains Protein: ENSMUSP00000139785
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR_TYP 221 244 3.7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201558
Predicted Effect probably benign
Transcript: ENSMUST00000201710
SMART Domains Protein: ENSMUSP00000144231
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201822
SMART Domains Protein: ENSMUSP00000144213
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 70 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202840
SMART Domains Protein: ENSMUSP00000144384
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 85 5.6e-23 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 99% (107/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a leucine-rich repeat and a death domain. This protein has been shown to interact with other death domain proteins, such as Fas (TNFRSF6)-associated via death domain (FADD) and MAP-kinase activating death domain-containing protein (MADD), and thus may function as an adaptor protein in cell death-related signaling processes. The expression of the mouse counterpart of this gene has been found to be positively regulated by the tumor suppressor p53 and to induce cell apoptosis in response to DNA damage, which suggests a role for this gene as an effector of p53-dependent apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele were viable and did not show fertility problems, gender bias, other overt phenotype, or any gross abnormalities in histological assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,883,631 I400F probably benign Het
4833423E24Rik T A 2: 85,518,551 R72S probably benign Het
4931409K22Rik T C 5: 24,545,785 probably null Het
Abca13 A T 11: 9,399,430 H3668L probably damaging Het
Acvr1c T C 2: 58,284,838 T313A probably damaging Het
Adam28 T C 14: 68,617,739 K651R probably damaging Het
Adamtsl3 A T 7: 82,521,990 D417V probably damaging Het
Adgrf4 A T 17: 42,667,313 C380S probably damaging Het
AI597479 T G 1: 43,111,117 L129R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa7 A C 14: 20,469,498 probably null Het
Arhgap22 A G 14: 33,369,417 R650G possibly damaging Het
Atp8a1 T A 5: 67,812,073 probably benign Het
Bcr C T 10: 75,181,634 T1209I possibly damaging Het
Bmpr1a C T 14: 34,429,777 S185N probably benign Het
Calcoco1 A T 15: 102,715,763 M246K probably benign Het
Casp12 T A 9: 5,345,534 probably benign Het
Ccno T A 13: 112,989,996 L333Q probably damaging Het
Cdhr2 T A 13: 54,734,801 probably benign Het
Cftr T A 6: 18,226,097 M318K probably null Het
Ckmt2 T A 13: 91,863,203 D96V possibly damaging Het
Cnnm1 C T 19: 43,441,910 P489L probably damaging Het
Cntnap1 A T 11: 101,188,309 D1175V probably damaging Het
Cpne5 A T 17: 29,211,660 L92H probably damaging Het
Crcp C A 5: 130,042,242 Q61K possibly damaging Het
Dcaf8 T A 1: 172,187,411 D414E probably benign Het
Ddx28 T C 8: 106,010,245 T394A probably benign Het
Ddx55 T C 5: 124,559,147 F191L probably benign Het
Dnaaf1 T C 8: 119,596,017 probably benign Het
Dnaaf2 C A 12: 69,197,744 R181L probably damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elf5 A G 2: 103,430,420 probably benign Het
Emcn T A 3: 137,416,814 probably benign Het
Erbb4 T C 1: 68,298,280 probably benign Het
Erbin C A 13: 103,868,865 C114F probably damaging Het
Etfdh T C 3: 79,609,844 I353V probably benign Het
Fam172a T A 13: 77,761,951 probably benign Het
Fbxl12 C T 9: 20,638,480 G316D probably damaging Het
Gbf1 G A 19: 46,272,270 probably null Het
Gbp2b T G 3: 142,608,176 S406A probably benign Het
Gli3 T G 13: 15,723,558 L741R probably damaging Het
Gmip G T 8: 69,810,818 S70I probably benign Het
Gnptab T C 10: 88,440,309 S1153P probably damaging Het
Gp1ba A G 11: 70,640,409 probably benign Het
Gramd1a T C 7: 31,138,254 D360G possibly damaging Het
Hectd4 T C 5: 121,259,864 I285T probably benign Het
Hrh4 A G 18: 13,007,245 probably benign Het
Hsp90b1 T C 10: 86,694,155 E226G probably damaging Het
Hspa13 A T 16: 75,765,130 D60E probably damaging Het
Htt T A 5: 34,817,134 probably benign Het
Ispd C T 12: 36,381,838 A22V possibly damaging Het
Kif14 G C 1: 136,496,026 probably benign Het
Kit T G 5: 75,652,829 V888G probably damaging Het
Lpin3 T C 2: 160,905,305 V827A probably benign Het
Lrriq4 T C 3: 30,655,724 S406P probably benign Het
Man2c1 T C 9: 57,141,183 V777A probably benign Het
Mcm8 A G 2: 132,819,994 K83E possibly damaging Het
Mep1a A G 17: 43,497,898 probably null Het
Mtor T A 4: 148,484,380 V1119E probably benign Het
Mybpc2 C T 7: 44,509,029 A710T possibly damaging Het
Myo9a C G 9: 59,923,677 T2368S probably damaging Het
Nbeal1 A G 1: 60,268,063 Y1684C probably damaging Het
Npm3 A G 19: 45,749,526 F11L probably benign Het
Nutf2 T A 8: 105,876,363 S37T probably damaging Het
Obscn T A 11: 59,040,441 I5790F probably damaging Het
Obscn A T 11: 59,052,506 D4833E probably damaging Het
Olfr1015 T A 2: 85,785,803 C97* probably null Het
Olfr123 A T 17: 37,795,989 M182L probably benign Het
Olfr39 T A 9: 20,285,857 S61T possibly damaging Het
Olfr955 T C 9: 39,470,556 T57A possibly damaging Het
Pcdhb1 A G 18: 37,267,024 D676G possibly damaging Het
Pcif1 G T 2: 164,889,444 R466L probably damaging Het
Pdk1 T C 2: 71,895,674 probably benign Het
Phxr2 T C 10: 99,126,117 probably benign Het
Plec A G 15: 76,191,418 probably null Het
Polr1a T A 6: 71,966,416 C1212S possibly damaging Het
Pot1a A G 6: 25,778,831 probably benign Het
Prdm5 T C 6: 65,862,903 probably benign Het
Primpol A T 8: 46,610,461 N53K probably damaging Het
Pyroxd1 A G 6: 142,361,976 I491V probably benign Het
Serpinb3b G T 1: 107,159,703 N25K probably damaging Het
Slc9b1 C T 3: 135,373,235 R218* probably null Het
Ssbp2 T A 13: 91,680,579 probably null Het
Stat4 A G 1: 52,090,870 probably benign Het
Steap4 T C 5: 7,975,829 V130A possibly damaging Het
Stoml2 A G 4: 43,030,238 probably null Het
Syne2 G T 12: 75,966,953 G2974C probably benign Het
Tfdp2 T G 9: 96,306,893 F200V probably damaging Het
Tgm4 T C 9: 123,048,557 probably null Het
Tie1 C A 4: 118,484,727 R175L probably benign Het
Tmem145 A G 7: 25,308,674 probably benign Het
Tsacc A G 3: 88,282,862 S94P possibly damaging Het
Tshz3 T A 7: 36,770,033 D482E probably benign Het
Tspan33 T C 6: 29,711,092 probably null Het
Ugt2b35 A G 5: 87,003,405 K290R probably null Het
Unc80 T C 1: 66,674,087 L2788P possibly damaging Het
Usp10 T A 8: 119,936,557 C39* probably null Het
Utp20 T A 10: 88,817,979 T260S probably benign Het
Vmn2r118 G T 17: 55,610,717 T265K probably damaging Het
Vmn2r7 C A 3: 64,691,018 C797F probably damaging Het
Vmn2r98 A C 17: 19,066,347 H369P probably benign Het
Vps39 A T 2: 120,338,787 Y245N possibly damaging Het
Wdr27 A G 17: 14,934,459 probably benign Het
Ythdc2 A G 18: 44,865,060 probably benign Het
Zcwpw2 C A 9: 118,014,055 noncoding transcript Het
Zdhhc1 C A 8: 105,483,543 A81S probably benign Het
Zfp729a G T 13: 67,620,354 H585Q probably damaging Het
Other mutations in Pidd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02751:Pidd1 APN 7 141439163 missense possibly damaging 0.93
IGL02794:Pidd1 APN 7 141443108 missense probably benign 0.00
IGL03083:Pidd1 APN 7 141440456 critical splice donor site probably null
IGL03347:Pidd1 APN 7 141439168 missense probably damaging 0.97
R0426:Pidd1 UTSW 7 141439133 missense probably damaging 1.00
R0650:Pidd1 UTSW 7 141440813 nonsense probably null
R0651:Pidd1 UTSW 7 141440813 nonsense probably null
R1201:Pidd1 UTSW 7 141440274 missense probably benign
R1221:Pidd1 UTSW 7 141438812 missense probably damaging 1.00
R1613:Pidd1 UTSW 7 141440777 missense probably damaging 1.00
R1763:Pidd1 UTSW 7 141439630 missense probably benign
R3967:Pidd1 UTSW 7 141439082 missense possibly damaging 0.86
R4072:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4073:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4075:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4076:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4157:Pidd1 UTSW 7 141441366 missense possibly damaging 0.87
R4501:Pidd1 UTSW 7 141441443 unclassified probably benign
R4700:Pidd1 UTSW 7 141442249 missense probably damaging 1.00
R4797:Pidd1 UTSW 7 141442986 missense possibly damaging 0.92
R4985:Pidd1 UTSW 7 141438591 makesense probably null
R5402:Pidd1 UTSW 7 141438594 missense probably damaging 1.00
R5684:Pidd1 UTSW 7 141441111 splice site probably null
R5790:Pidd1 UTSW 7 141441392 unclassified probably benign
R5909:Pidd1 UTSW 7 141441270 missense probably damaging 1.00
R6275:Pidd1 UTSW 7 141439795 missense probably damaging 1.00
R6582:Pidd1 UTSW 7 141439581 missense probably damaging 1.00
R6814:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6872:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6935:Pidd1 UTSW 7 141440302 missense probably damaging 1.00
R7088:Pidd1 UTSW 7 141440487 missense probably damaging 1.00
R7133:Pidd1 UTSW 7 141439900 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGCATCAAGGAGAAGTCAGTCCC -3'
(R):5'- GAAGTTCTTTGCAGCCTTTGAGCG -3'

Sequencing Primer
(F):5'- AGAAAGCTTGGACCCATTCTC -3'
(R):5'- GAGTGACACTTTGGCCCCTC -3'
Posted On2013-08-08