Incidental Mutation 'R0329:Kit'
ID25943
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission 038538-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R0329 (G1)
Quality Score218
Status Validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 75652829 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 888 (V888G)
Ref Sequence ENSEMBL: ENSMUSP00000116465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: V892G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: V892G

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144270
AA Change: V888G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: V888G

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202167
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 99% (107/108)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,883,631 I400F probably benign Het
4833423E24Rik T A 2: 85,518,551 R72S probably benign Het
4931409K22Rik T C 5: 24,545,785 N600S probably null Het
Abca13 A T 11: 9,399,430 H3668L probably damaging Het
Acvr1c T C 2: 58,284,838 T313A probably damaging Het
Adam28 T C 14: 68,617,739 K651R probably damaging Het
Adamtsl3 A T 7: 82,521,990 D417V probably damaging Het
Adgrf4 A T 17: 42,667,313 C380S probably damaging Het
AI597479 T G 1: 43,111,117 L129R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa7 A C 14: 20,469,498 probably null Het
Arhgap22 A G 14: 33,369,417 R650G possibly damaging Het
Atp8a1 T A 5: 67,812,073 probably benign Het
Bcr C T 10: 75,181,634 T1209I possibly damaging Het
Bmpr1a C T 14: 34,429,777 S185N probably benign Het
Calcoco1 A T 15: 102,715,763 M246K probably benign Het
Casp12 T A 9: 5,345,534 probably benign Het
Ccno T A 13: 112,989,996 L333Q probably damaging Het
Cdhr2 T A 13: 54,734,801 probably benign Het
Cftr T A 6: 18,226,097 M348K probably null Het
Ckmt2 T A 13: 91,863,203 D96V possibly damaging Het
Cnnm1 C T 19: 43,441,910 P489L probably damaging Het
Cntnap1 A T 11: 101,188,309 D1175V probably damaging Het
Cpne5 A T 17: 29,211,660 L92H probably damaging Het
Crcp C A 5: 130,042,242 Q61K possibly damaging Het
Dcaf8 T A 1: 172,187,411 D414E probably benign Het
Ddx28 T C 8: 106,010,245 T394A probably benign Het
Ddx55 T C 5: 124,559,147 F191L probably benign Het
Dnaaf1 T C 8: 119,596,017 probably benign Het
Dnaaf2 C A 12: 69,197,744 R181L probably damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elf5 A G 2: 103,430,420 probably benign Het
Emcn T A 3: 137,416,814 probably benign Het
Erbb4 T C 1: 68,298,280 probably benign Het
Erbin C A 13: 103,868,865 C114F probably damaging Het
Etfdh T C 3: 79,609,844 I413V probably benign Het
Fam172a T A 13: 77,761,951 probably benign Het
Fbxl12 C T 9: 20,638,480 G316D probably damaging Het
Gbf1 G A 19: 46,272,270 probably null Het
Gbp2b T G 3: 142,608,176 S406A probably benign Het
Gli3 T G 13: 15,723,558 L741R probably damaging Het
Gmip G T 8: 69,810,818 S70I probably benign Het
Gnptab T C 10: 88,440,309 S1153P probably damaging Het
Gp1ba A G 11: 70,640,409 I334V probably benign Het
Gramd1a T C 7: 31,138,254 D360G possibly damaging Het
Hectd4 T C 5: 121,259,864 I285T probably benign Het
Hrh4 A G 18: 13,007,245 probably benign Het
Hsp90b1 T C 10: 86,694,155 E226G probably damaging Het
Hspa13 A T 16: 75,765,130 D60E probably damaging Het
Htt T A 5: 34,817,134 probably benign Het
Ispd C T 12: 36,381,838 A22V possibly damaging Het
Kif14 G C 1: 136,496,026 probably benign Het
Lpin3 T C 2: 160,905,305 V827A probably benign Het
Lrriq4 T C 3: 30,655,724 S406P probably benign Het
Man2c1 T C 9: 57,141,183 V777A probably benign Het
Mcm8 A G 2: 132,819,994 K83E possibly damaging Het
Mep1a A G 17: 43,497,898 probably null Het
Mtor T A 4: 148,484,380 V1119E probably benign Het
Mybpc2 C T 7: 44,509,029 A710T possibly damaging Het
Myo9a C G 9: 59,923,677 T2368S probably damaging Het
Nbeal1 A G 1: 60,268,063 Y1684C probably damaging Het
Npm3 A G 19: 45,749,526 F11L probably benign Het
Nutf2 T A 8: 105,876,363 S37T probably damaging Het
Obscn T A 11: 59,040,441 I5790F probably damaging Het
Obscn A T 11: 59,052,506 D4833E probably damaging Het
Olfr1015 T A 2: 85,785,803 C97* probably null Het
Olfr123 A T 17: 37,795,989 M182L probably benign Het
Olfr39 T A 9: 20,285,857 S61T possibly damaging Het
Olfr955 T C 9: 39,470,556 T57A possibly damaging Het
Pcdhb1 A G 18: 37,267,024 D676G possibly damaging Het
Pcif1 G T 2: 164,889,444 R466L probably damaging Het
Pdk1 T C 2: 71,895,674 probably benign Het
Phxr2 T C 10: 99,126,117 K27R probably benign Het
Pidd1 A T 7: 141,439,561 probably benign Het
Plec A G 15: 76,191,418 probably null Het
Polr1a T A 6: 71,966,416 C1212S possibly damaging Het
Pot1a A G 6: 25,778,831 probably benign Het
Prdm5 T C 6: 65,862,903 probably benign Het
Primpol A T 8: 46,610,461 N53K probably damaging Het
Pyroxd1 A G 6: 142,361,976 I491V probably benign Het
Serpinb3b G T 1: 107,159,703 N25K probably damaging Het
Slc9b1 C T 3: 135,373,235 R218* probably null Het
Ssbp2 T A 13: 91,680,579 probably null Het
Stat4 A G 1: 52,090,870 probably benign Het
Steap4 T C 5: 7,975,829 V130A possibly damaging Het
Stoml2 A G 4: 43,030,238 probably null Het
Syne2 G T 12: 75,966,953 G2974C probably benign Het
Tfdp2 T G 9: 96,306,893 F276V probably damaging Het
Tgm4 T C 9: 123,048,557 probably null Het
Tie1 C A 4: 118,484,727 R175L probably benign Het
Tmem145 A G 7: 25,308,674 probably benign Het
Tsacc A G 3: 88,282,862 S94P possibly damaging Het
Tshz3 T A 7: 36,770,033 D482E probably benign Het
Tspan33 T C 6: 29,711,092 probably null Het
Ugt2b35 A G 5: 87,003,405 K290R probably null Het
Unc80 T C 1: 66,674,087 L2788P possibly damaging Het
Usp10 T A 8: 119,936,557 C39* probably null Het
Utp20 T A 10: 88,817,979 T260S probably benign Het
Vmn2r118 G T 17: 55,610,717 T265K probably damaging Het
Vmn2r7 C A 3: 64,691,018 C797F probably damaging Het
Vmn2r98 A C 17: 19,066,347 H369P probably benign Het
Vps39 A T 2: 120,338,787 Y245N possibly damaging Het
Wdr27 A G 17: 14,934,459 probably benign Het
Ythdc2 A G 18: 44,865,060 probably benign Het
Zcwpw2 C A 9: 118,014,055 noncoding transcript Het
Zdhhc1 C A 8: 105,483,543 A81S probably benign Het
Zfp729a G T 13: 67,620,354 H585Q probably damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATGGCACCAGAGAGCATTTTCAG -3'
(R):5'- CATAGCGCGTGAGTGACATACAGAG -3'

Sequencing Primer
(F):5'- CACATTTGAAAGTGATGTCTGGTCC -3'
(R):5'- ACTGTCAAAAGCTTCGGTGC -3'
Posted On2013-04-16