Mutagenetix > Incidental Mutation

Incidental Mutation 'R0844:Trnt1'

77289

Institutional Source

Beutler Lab

Gene Symbol

Trnt1

Ensembl Gene

ENSMUSG00000013736

Gene Name

tRNA nucleotidyl transferase, CCA-adding, 1

Synonyms

CGI-47, 2610044E04Rik, 2410043H24Rik

MMRRC Submission

039023-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R0844 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106746099-106759435 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106751464 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 147 (D147G)

Ref Sequence

ENSEMBL: ENSMUSP00000108875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057578] [ENSMUST00000113247] [ENSMUST00000113248] [ENSMUST00000113249] [ENSMUST00000204782] [ENSMUST00000205163]

AlphaFold

Q8K1J6

Predicted Effect

probably damaging
Transcript: ENSMUST00000057578
AA Change: D147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000060900
Gene: ENSMUSG00000013736
AA Change: D147G

Domain	Start	End	E-Value	Type
Pfam:PolyA_pol	59	182	3.8e-36	PFAM
Pfam:PolyA_pol_RNAbd	215	271	1.4e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113247
AA Change: D147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108873
Gene: ENSMUSG00000013736
AA Change: D147G

Domain	Start	End	E-Value	Type
Pfam:PolyA_pol	59	182	7.7e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113248
AA Change: D147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108874
Gene: ENSMUSG00000013736
AA Change: D147G

Domain	Start	End	E-Value	Type
Pfam:PolyA_pol	59	182	2.4e-37	PFAM
Pfam:PolyA_pol_RNAbd	215	272	9.3e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113249
AA Change: D147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108875
Gene: ENSMUSG00000013736
AA Change: D147G

Domain	Start	End	E-Value	Type
Pfam:PolyA_pol	59	182	3.8e-36	PFAM
Pfam:PolyA_pol_RNAbd	215	271	1.4e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147084

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154026

Predicted Effect

probably benign
Transcript: ENSMUST00000204782

SMART Domains

Protein: ENSMUSP00000144850
Gene: ENSMUSG00000013736

Domain	Start	End	E-Value	Type
Pfam:PolyA_pol	59	134	3e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205163

SMART Domains

Protein: ENSMUSP00000144943
Gene: ENSMUSG00000013736

Domain	Start	End	E-Value	Type
PDB:1OU5\|B	30	72	2e-22	PDB

Meta Mutation Damage Score

0.9732

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.7%
20x: 95.8%

Validation Efficiency

100% (27/27)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a CCA-adding enzyme which belongs to the tRNA nucleotidyltransferase/poly(A) polymerase family. This essential enzyme functions by catalyzing the addition of the conserved nucleotide triplet CCA to the 3' terminus of tRNA molecules. Mutations in this gene result in sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	T	C	12: 55,126,858 (GRCm39)	D2G	possibly damaging	Het
Abca5	T	C	11: 110,210,658 (GRCm39)	T174A	probably benign	Het
Asb2	T	C	12: 103,291,805 (GRCm39)	H374R	probably damaging	Het
Clca4b	A	G	3: 144,622,532 (GRCm39)	I511T	probably damaging	Het
Cnmd	G	A	14: 79,879,391 (GRCm39)	T249I	probably benign	Het
Cyp4a12b	T	G	4: 115,289,721 (GRCm39)	M196R	possibly damaging	Het
Ddx60	T	C	8: 62,440,395 (GRCm39)	Y1016H	probably benign	Het
Elapor1	T	C	3: 108,388,279 (GRCm39)		probably benign	Het
Ero1a	A	G	14: 45,530,457 (GRCm39)	L325P	probably damaging	Het
Etv1	T	C	12: 38,911,353 (GRCm39)	L393P	probably damaging	Het
Fdx1	G	T	9: 51,859,909 (GRCm39)	D33E	probably damaging	Het
Gpr180	T	C	14: 118,395,359 (GRCm39)	C264R	probably damaging	Het
Grik2	A	T	10: 48,977,211 (GRCm39)	M907K	possibly damaging	Het
Itga10	C	T	3: 96,559,054 (GRCm39)		probably benign	Het
Klrh1	C	G	6: 129,752,756 (GRCm39)	K16N	possibly damaging	Het
Mpdz	A	G	4: 81,339,431 (GRCm39)		probably benign	Het
Myo9b	C	T	8: 71,743,119 (GRCm39)	S60L	probably benign	Het
Naxe	A	T	3: 87,965,715 (GRCm39)	V28E	probably benign	Het
Nup155	A	T	15: 8,187,244 (GRCm39)	H1391L	probably damaging	Het
Otog	T	C	7: 45,937,252 (GRCm39)	S1654P	possibly damaging	Het
Setd1b	C	T	5: 123,298,748 (GRCm39)		probably benign	Het
Spag17	A	G	3: 99,912,101 (GRCm39)	T324A	probably benign	Het
Sucla2	C	T	14: 73,798,074 (GRCm39)		probably benign	Het
Tbc1d12	G	T	19: 38,825,515 (GRCm39)	R122L	probably benign	Het
Tmx4	A	G	2: 134,441,928 (GRCm39)		probably null	Het
Trpm7	A	T	2: 126,677,428 (GRCm39)	V463E	probably damaging	Het
Wdr82	G	A	9: 106,065,780 (GRCm39)		probably benign	Het

Other mutations in Trnt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Trnt1	APN	6	106,753,183 (GRCm39)	nonsense	probably null
IGL00915:Trnt1	APN	6	106,756,387 (GRCm39)	missense	probably benign	0.00
IGL01821:Trnt1	APN	6	106,751,436 (GRCm39)	missense	probably damaging	1.00
IGL02102:Trnt1	APN	6	106,755,073 (GRCm39)	critical splice donor site	probably null
IGL02610:Trnt1	APN	6	106,755,779 (GRCm39)	missense	possibly damaging	0.88
IGL02933:Trnt1	APN	6	106,750,387 (GRCm39)	missense	probably benign	0.40
R0606:Trnt1	UTSW	6	106,754,869 (GRCm39)	unclassified	probably benign
R2144:Trnt1	UTSW	6	106,755,000 (GRCm39)	missense	probably damaging	1.00
R2495:Trnt1	UTSW	6	106,750,330 (GRCm39)	missense	possibly damaging	0.88
R4994:Trnt1	UTSW	6	106,755,853 (GRCm39)	nonsense	probably null
R5294:Trnt1	UTSW	6	106,750,375 (GRCm39)	missense	probably damaging	1.00
R5742:Trnt1	UTSW	6	106,755,878 (GRCm39)	nonsense	probably null
R6855:Trnt1	UTSW	6	106,754,883 (GRCm39)	missense	probably damaging	1.00
R7491:Trnt1	UTSW	6	106,755,865 (GRCm39)	missense	probably benign
R7492:Trnt1	UTSW	6	106,751,493 (GRCm39)	missense	possibly damaging	0.76
R7880:Trnt1	UTSW	6	106,746,517 (GRCm39)	critical splice donor site	probably null
R8212:Trnt1	UTSW	6	106,746,832 (GRCm39)	missense	probably benign
R8863:Trnt1	UTSW	6	106,751,443 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGAACGACCAACTCCATCCTTC -3'
(R):5'- CCAACAGACTCCGATAGGTTCAACG -3'

Sequencing Primer
(F):5'- cctgctcccaaacctgac -3'
(R):5'- GACTCCGATAGGTTCAACGTAAATG -3'

Posted On

2013-10-16