Incidental Mutation 'R0845:Col1a2'
ID77317
Institutional Source Beutler Lab
Gene Symbol Col1a2
Ensembl Gene ENSMUSG00000029661
Gene Namecollagen, type I, alpha 2
SynonymsCola2, Cola-2, Col1a-2
MMRRC Submission 039024-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0845 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4504814-4541544 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 4518822 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031668] [ENSMUST00000141483]
Predicted Effect unknown
Transcript: ENSMUST00000031668
AA Change: R230H
SMART Domains Protein: ENSMUSP00000031668
Gene: ENSMUSG00000029661
AA Change: R230H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 30 91 1e-8 PFAM
Pfam:Collagen 88 155 8.2e-10 PFAM
internal_repeat_3 172 223 7.52e-12 PROSPERO
low complexity region 225 271 N/A INTRINSIC
low complexity region 274 313 N/A INTRINSIC
low complexity region 316 352 N/A INTRINSIC
internal_repeat_2 354 386 2.06e-15 PROSPERO
internal_repeat_1 355 469 5.71e-17 PROSPERO
internal_repeat_4 361 472 2.1e-11 PROSPERO
Pfam:Collagen 475 535 7.7e-11 PFAM
Pfam:Collagen 521 588 8.2e-10 PFAM
low complexity region 598 625 N/A INTRINSIC
low complexity region 628 655 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 724 757 N/A INTRINSIC
low complexity region 759 784 N/A INTRINSIC
low complexity region 792 820 N/A INTRINSIC
internal_repeat_5 823 850 5.93e-7 PROSPERO
low complexity region 853 883 N/A INTRINSIC
Pfam:Collagen 895 969 1e-8 PFAM
low complexity region 987 1007 N/A INTRINSIC
internal_repeat_5 1009 1042 5.93e-7 PROSPERO
Pfam:Collagen 1051 1120 5.8e-9 PFAM
COLFI 1138 1372 2.1e-150 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138511
Predicted Effect probably benign
Transcript: ENSMUST00000141483
SMART Domains Protein: ENSMUSP00000125275
Gene: ENSMUSG00000029661

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 30 89 3.2e-10 PFAM
Pfam:Collagen 87 145 8.5e-10 PFAM
Pfam:Collagen 121 177 3.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148864
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-1 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice harboring certain mutations in the encoded gene exhibit symptoms of moderate to severe forms of osteogenesis imperfecta. [provided by RefSeq, Dec 2015]
PHENOTYPE: The tails of mice heterozygous for an ENU-induced mutation at this locus are flexible or rubbery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 G T 7: 28,913,430 A116E probably damaging Het
Adamtsl3 A G 7: 82,575,996 I338V probably damaging Het
Akap13 T G 7: 75,725,380 V1920G probably damaging Het
Atp6v0d2 C T 4: 19,880,055 V281I probably benign Het
AW209491 T G 13: 14,637,022 S153R probably damaging Het
Brd7 A T 8: 88,342,767 Y433* probably null Het
Bub1b A G 2: 118,609,976 H187R probably damaging Het
Clstn2 T A 9: 97,570,628 Q242L probably benign Het
Comt T C 16: 18,407,961 Y225C probably damaging Het
Ctbs T A 3: 146,455,107 L143Q probably damaging Het
Ctsw T C 19: 5,465,461 probably benign Het
Dhx16 T C 17: 35,883,302 I435T probably damaging Het
Dmxl1 T C 18: 49,893,402 F1859S probably damaging Het
Glud1 A G 14: 34,329,394 probably benign Het
Gm8220 A G 14: 44,286,791 H71R probably damaging Het
Gnb1l A G 16: 18,552,473 E238G probably benign Het
H2-T23 T C 17: 36,030,583 H332R probably benign Het
Itga5 T A 15: 103,350,769 T744S probably benign Het
Larp1 A G 11: 58,047,750 E453G probably benign Het
Lrrk2 C A 15: 91,755,962 P1570Q probably benign Het
Lrsam1 C T 2: 32,953,443 R150Q possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Msln T C 17: 25,750,796 Y320C probably damaging Het
Mtbp T C 15: 55,563,090 probably null Het
Muc5b A G 7: 141,850,446 probably null Het
Mup21 A G 4: 62,150,310 S40P probably damaging Het
Myh8 T C 11: 67,286,264 V414A probably damaging Het
P2rx5 T C 11: 73,165,574 I108T probably damaging Het
Paqr9 T C 9: 95,560,740 L261P probably damaging Het
Pde5a A G 3: 122,729,331 D29G probably benign Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pih1d1 A G 7: 45,159,682 D230G probably benign Het
Pik3r1 G T 13: 101,686,264 D643E probably benign Het
Rnf207 A G 4: 152,312,064 probably benign Het
Sept9 T C 11: 117,356,325 probably benign Het
Serinc1 A T 10: 57,525,383 S105T probably benign Het
Slc8a1 A G 17: 81,437,748 S676P probably benign Het
Srrm4 C T 5: 116,444,885 probably null Het
Tcn2 T A 11: 3,919,349 D391V probably benign Het
Tmem131 T C 1: 36,816,222 T808A probably damaging Het
Ubqln3 G T 7: 104,142,068 Q272K probably damaging Het
Unc79 T C 12: 103,173,444 probably benign Het
Xpo6 G A 7: 126,129,543 probably benign Het
Zfp667 A T 7: 6,306,092 K586N possibly damaging Het
Other mutations in Col1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Col1a2 APN 6 4531095 splice site probably benign
IGL01126:Col1a2 APN 6 4535846 missense unknown
IGL01129:Col1a2 APN 6 4535846 missense unknown
IGL01286:Col1a2 APN 6 4533891 missense unknown
IGL01687:Col1a2 APN 6 4520258 nonsense probably null
IGL01866:Col1a2 APN 6 4524132 missense probably damaging 1.00
IGL02010:Col1a2 APN 6 4512416 critical splice donor site probably null
IGL02100:Col1a2 APN 6 4524177 splice site probably benign
IGL02140:Col1a2 APN 6 4515639 missense unknown
IGL02474:Col1a2 APN 6 4516398 missense unknown
IGL02510:Col1a2 APN 6 4516398 missense unknown
IGL02525:Col1a2 APN 6 4531355 splice site probably benign
IGL02839:Col1a2 APN 6 4538748 missense unknown
IGL03134:Col1a2 APN 6 4521387 unclassified probably benign
IGL03385:Col1a2 APN 6 4539612 missense unknown
P4717OSA:Col1a2 UTSW 6 4518822 unclassified probably benign
PIT4453001:Col1a2 UTSW 6 4527079 missense possibly damaging 0.94
R0021:Col1a2 UTSW 6 4518822 unclassified probably benign
R0022:Col1a2 UTSW 6 4518822 unclassified probably benign
R0025:Col1a2 UTSW 6 4518822 unclassified probably benign
R0027:Col1a2 UTSW 6 4518822 unclassified probably benign
R0028:Col1a2 UTSW 6 4518822 unclassified probably benign
R0031:Col1a2 UTSW 6 4518822 unclassified probably benign
R0038:Col1a2 UTSW 6 4518822 unclassified probably benign
R0064:Col1a2 UTSW 6 4518822 unclassified probably benign
R0102:Col1a2 UTSW 6 4520775 missense possibly damaging 0.92
R0147:Col1a2 UTSW 6 4518822 unclassified probably benign
R0323:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4537838 missense unknown
R0335:Col1a2 UTSW 6 4531956 splice site probably benign
R0359:Col1a2 UTSW 6 4518822 unclassified probably benign
R0363:Col1a2 UTSW 6 4518822 unclassified probably benign
R0612:Col1a2 UTSW 6 4516003 missense unknown
R0729:Col1a2 UTSW 6 4518822 unclassified probably benign
R0746:Col1a2 UTSW 6 4518822 unclassified probably benign
R0760:Col1a2 UTSW 6 4518822 unclassified probably benign
R0761:Col1a2 UTSW 6 4518822 unclassified probably benign
R0801:Col1a2 UTSW 6 4531316 missense unknown
R0846:Col1a2 UTSW 6 4518822 unclassified probably benign
R0969:Col1a2 UTSW 6 4518822 unclassified probably benign
R0970:Col1a2 UTSW 6 4518822 unclassified probably benign
R1105:Col1a2 UTSW 6 4518822 unclassified probably benign
R1106:Col1a2 UTSW 6 4518822 unclassified probably benign
R1107:Col1a2 UTSW 6 4518822 unclassified probably benign
R1134:Col1a2 UTSW 6 4518822 unclassified probably benign
R1135:Col1a2 UTSW 6 4518822 unclassified probably benign
R1152:Col1a2 UTSW 6 4518822 unclassified probably benign
R1333:Col1a2 UTSW 6 4515684 critical splice donor site probably null
R1341:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1477:Col1a2 UTSW 6 4539673 missense unknown
R1566:Col1a2 UTSW 6 4523613 missense probably damaging 1.00
R1691:Col1a2 UTSW 6 4536038 missense unknown
R1713:Col1a2 UTSW 6 4538691 missense unknown
R1754:Col1a2 UTSW 6 4518822 unclassified probably benign
R1755:Col1a2 UTSW 6 4518822 unclassified probably benign
R2050:Col1a2 UTSW 6 4518822 unclassified probably benign
R2178:Col1a2 UTSW 6 4531143 missense unknown
R2194:Col1a2 UTSW 6 4518822 unclassified probably benign
R2195:Col1a2 UTSW 6 4518822 unclassified probably benign
R2235:Col1a2 UTSW 6 4518822 unclassified probably benign
R2261:Col1a2 UTSW 6 4518822 unclassified probably benign
R2262:Col1a2 UTSW 6 4518822 unclassified probably benign
R2263:Col1a2 UTSW 6 4518822 unclassified probably benign
R2289:Col1a2 UTSW 6 4518822 unclassified probably benign
R2310:Col1a2 UTSW 6 4518822 unclassified probably benign
R2312:Col1a2 UTSW 6 4518822 unclassified probably benign
R2330:Col1a2 UTSW 6 4528300 splice site probably benign
R2333:Col1a2 UTSW 6 4532747 missense unknown
R2401:Col1a2 UTSW 6 4518822 unclassified probably benign
R2403:Col1a2 UTSW 6 4518822 unclassified probably benign
R2448:Col1a2 UTSW 6 4518822 unclassified probably benign
R2513:Col1a2 UTSW 6 4531223 splice site probably null
R2862:Col1a2 UTSW 6 4518822 unclassified probably benign
R2884:Col1a2 UTSW 6 4518822 unclassified probably benign
R2885:Col1a2 UTSW 6 4518822 unclassified probably benign
R2913:Col1a2 UTSW 6 4519923 unclassified probably benign
R2937:Col1a2 UTSW 6 4519882 unclassified probably benign
R2937:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R2938:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R3608:Col1a2 UTSW 6 4518822 unclassified probably benign
R3692:Col1a2 UTSW 6 4510710 missense possibly damaging 0.84
R3805:Col1a2 UTSW 6 4518822 unclassified probably benign
R3806:Col1a2 UTSW 6 4518822 unclassified probably benign
R3826:Col1a2 UTSW 6 4516960 unclassified probably benign
R3903:Col1a2 UTSW 6 4518822 unclassified probably benign
R3904:Col1a2 UTSW 6 4518822 unclassified probably benign
R3922:Col1a2 UTSW 6 4518822 unclassified probably benign
R3926:Col1a2 UTSW 6 4518822 unclassified probably benign
R4106:Col1a2 UTSW 6 4518822 unclassified probably benign
R4107:Col1a2 UTSW 6 4518822 unclassified probably benign
R4108:Col1a2 UTSW 6 4518822 unclassified probably benign
R4109:Col1a2 UTSW 6 4510705 nonsense probably null
R4509:Col1a2 UTSW 6 4518822 unclassified probably benign
R4667:Col1a2 UTSW 6 4512412 missense unknown
R4909:Col1a2 UTSW 6 4529058 splice site probably benign
R5418:Col1a2 UTSW 6 4516931 unclassified probably benign
R5587:Col1a2 UTSW 6 4540531 missense unknown
R5598:Col1a2 UTSW 6 4516916 unclassified probably benign
R5673:Col1a2 UTSW 6 4539622 missense unknown
R5678:Col1a2 UTSW 6 4536239 missense unknown
R5763:Col1a2 UTSW 6 4515682 missense unknown
R5786:Col1a2 UTSW 6 4530223 missense unknown
R5872:Col1a2 UTSW 6 4531926 missense unknown
R6084:Col1a2 UTSW 6 4505840 start codon destroyed probably benign 0.01
R6134:Col1a2 UTSW 6 4538035 missense unknown
R6221:Col1a2 UTSW 6 4539490 missense unknown
R6481:Col1a2 UTSW 6 4538680 missense unknown
R6500:Col1a2 UTSW 6 4515517 missense unknown
R6890:Col1a2 UTSW 6 4539587 missense unknown
R7022:Col1a2 UTSW 6 4534639 missense unknown
R7033:Col1a2 UTSW 6 4516904 unclassified probably benign
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
X0017:Col1a2 UTSW 6 4515675 missense unknown
Predicted Primers PCR Primer
(F):5'- AATGGAACTCCAGGTCAAGCAGTG -3'
(R):5'- ACTCGCCAGTGTCAGGACTTACAG -3'

Sequencing Primer
(F):5'- TGAGTATTGACCAATCCACTGGC -3'
(R):5'- TCAGGACTTACAGCAGGGC -3'
Posted On2013-10-16