Incidental Mutation 'R0038:Col1a2'
ID32808
Institutional Source Beutler Lab
Gene Symbol Col1a2
Ensembl Gene ENSMUSG00000029661
Gene Namecollagen, type I, alpha 2
SynonymsCola2, Cola-2, Col1a-2
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0038 (G1)
Quality Score188
Status Validated (trace)
Chromosome6
Chromosomal Location4504814-4541544 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 4518822 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031668] [ENSMUST00000141483]
Predicted Effect unknown
Transcript: ENSMUST00000031668
AA Change: R230H
SMART Domains Protein: ENSMUSP00000031668
Gene: ENSMUSG00000029661
AA Change: R230H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 30 91 1e-8 PFAM
Pfam:Collagen 88 155 8.2e-10 PFAM
internal_repeat_3 172 223 7.52e-12 PROSPERO
low complexity region 225 271 N/A INTRINSIC
low complexity region 274 313 N/A INTRINSIC
low complexity region 316 352 N/A INTRINSIC
internal_repeat_2 354 386 2.06e-15 PROSPERO
internal_repeat_1 355 469 5.71e-17 PROSPERO
internal_repeat_4 361 472 2.1e-11 PROSPERO
Pfam:Collagen 475 535 7.7e-11 PFAM
Pfam:Collagen 521 588 8.2e-10 PFAM
low complexity region 598 625 N/A INTRINSIC
low complexity region 628 655 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 724 757 N/A INTRINSIC
low complexity region 759 784 N/A INTRINSIC
low complexity region 792 820 N/A INTRINSIC
internal_repeat_5 823 850 5.93e-7 PROSPERO
low complexity region 853 883 N/A INTRINSIC
Pfam:Collagen 895 969 1e-8 PFAM
low complexity region 987 1007 N/A INTRINSIC
internal_repeat_5 1009 1042 5.93e-7 PROSPERO
Pfam:Collagen 1051 1120 5.8e-9 PFAM
COLFI 1138 1372 2.1e-150 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138511
Predicted Effect probably benign
Transcript: ENSMUST00000141483
SMART Domains Protein: ENSMUSP00000125275
Gene: ENSMUSG00000029661

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 30 89 3.2e-10 PFAM
Pfam:Collagen 87 145 8.5e-10 PFAM
Pfam:Collagen 121 177 3.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148864
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-1 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice harboring certain mutations in the encoded gene exhibit symptoms of moderate to severe forms of osteogenesis imperfecta. [provided by RefSeq, Dec 2015]
PHENOTYPE: The tails of mice heterozygous for an ENU-induced mutation at this locus are flexible or rubbery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Col1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Col1a2 APN 6 4531095 splice site probably benign
IGL01126:Col1a2 APN 6 4535846 missense unknown
IGL01129:Col1a2 APN 6 4535846 missense unknown
IGL01286:Col1a2 APN 6 4533891 missense unknown
IGL01687:Col1a2 APN 6 4520258 nonsense probably null
IGL01866:Col1a2 APN 6 4524132 missense probably damaging 1.00
IGL02010:Col1a2 APN 6 4512416 critical splice donor site probably null
IGL02100:Col1a2 APN 6 4524177 splice site probably benign
IGL02140:Col1a2 APN 6 4515639 missense unknown
IGL02474:Col1a2 APN 6 4516398 missense unknown
IGL02510:Col1a2 APN 6 4516398 missense unknown
IGL02525:Col1a2 APN 6 4531355 splice site probably benign
IGL02839:Col1a2 APN 6 4538748 missense unknown
IGL03134:Col1a2 APN 6 4521387 unclassified probably benign
IGL03385:Col1a2 APN 6 4539612 missense unknown
P4717OSA:Col1a2 UTSW 6 4518822 unclassified probably benign
PIT4453001:Col1a2 UTSW 6 4527079 missense possibly damaging 0.94
R0021:Col1a2 UTSW 6 4518822 unclassified probably benign
R0022:Col1a2 UTSW 6 4518822 unclassified probably benign
R0025:Col1a2 UTSW 6 4518822 unclassified probably benign
R0027:Col1a2 UTSW 6 4518822 unclassified probably benign
R0028:Col1a2 UTSW 6 4518822 unclassified probably benign
R0031:Col1a2 UTSW 6 4518822 unclassified probably benign
R0064:Col1a2 UTSW 6 4518822 unclassified probably benign
R0102:Col1a2 UTSW 6 4520775 missense possibly damaging 0.92
R0147:Col1a2 UTSW 6 4518822 unclassified probably benign
R0323:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4537838 missense unknown
R0335:Col1a2 UTSW 6 4531956 splice site probably benign
R0359:Col1a2 UTSW 6 4518822 unclassified probably benign
R0363:Col1a2 UTSW 6 4518822 unclassified probably benign
R0612:Col1a2 UTSW 6 4516003 missense unknown
R0729:Col1a2 UTSW 6 4518822 unclassified probably benign
R0746:Col1a2 UTSW 6 4518822 unclassified probably benign
R0760:Col1a2 UTSW 6 4518822 unclassified probably benign
R0761:Col1a2 UTSW 6 4518822 unclassified probably benign
R0801:Col1a2 UTSW 6 4531316 missense unknown
R0845:Col1a2 UTSW 6 4518822 unclassified probably benign
R0846:Col1a2 UTSW 6 4518822 unclassified probably benign
R0969:Col1a2 UTSW 6 4518822 unclassified probably benign
R0970:Col1a2 UTSW 6 4518822 unclassified probably benign
R1105:Col1a2 UTSW 6 4518822 unclassified probably benign
R1106:Col1a2 UTSW 6 4518822 unclassified probably benign
R1107:Col1a2 UTSW 6 4518822 unclassified probably benign
R1134:Col1a2 UTSW 6 4518822 unclassified probably benign
R1135:Col1a2 UTSW 6 4518822 unclassified probably benign
R1152:Col1a2 UTSW 6 4518822 unclassified probably benign
R1333:Col1a2 UTSW 6 4515684 critical splice donor site probably null
R1341:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1477:Col1a2 UTSW 6 4539673 missense unknown
R1566:Col1a2 UTSW 6 4523613 missense probably damaging 1.00
R1691:Col1a2 UTSW 6 4536038 missense unknown
R1713:Col1a2 UTSW 6 4538691 missense unknown
R1754:Col1a2 UTSW 6 4518822 unclassified probably benign
R1755:Col1a2 UTSW 6 4518822 unclassified probably benign
R2050:Col1a2 UTSW 6 4518822 unclassified probably benign
R2178:Col1a2 UTSW 6 4531143 missense unknown
R2194:Col1a2 UTSW 6 4518822 unclassified probably benign
R2195:Col1a2 UTSW 6 4518822 unclassified probably benign
R2235:Col1a2 UTSW 6 4518822 unclassified probably benign
R2261:Col1a2 UTSW 6 4518822 unclassified probably benign
R2262:Col1a2 UTSW 6 4518822 unclassified probably benign
R2263:Col1a2 UTSW 6 4518822 unclassified probably benign
R2289:Col1a2 UTSW 6 4518822 unclassified probably benign
R2310:Col1a2 UTSW 6 4518822 unclassified probably benign
R2312:Col1a2 UTSW 6 4518822 unclassified probably benign
R2330:Col1a2 UTSW 6 4528300 splice site probably benign
R2333:Col1a2 UTSW 6 4532747 missense unknown
R2401:Col1a2 UTSW 6 4518822 unclassified probably benign
R2403:Col1a2 UTSW 6 4518822 unclassified probably benign
R2448:Col1a2 UTSW 6 4518822 unclassified probably benign
R2513:Col1a2 UTSW 6 4531223 splice site probably null
R2862:Col1a2 UTSW 6 4518822 unclassified probably benign
R2884:Col1a2 UTSW 6 4518822 unclassified probably benign
R2885:Col1a2 UTSW 6 4518822 unclassified probably benign
R2913:Col1a2 UTSW 6 4519923 unclassified probably benign
R2937:Col1a2 UTSW 6 4519882 unclassified probably benign
R2937:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R2938:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R3608:Col1a2 UTSW 6 4518822 unclassified probably benign
R3692:Col1a2 UTSW 6 4510710 missense possibly damaging 0.84
R3805:Col1a2 UTSW 6 4518822 unclassified probably benign
R3806:Col1a2 UTSW 6 4518822 unclassified probably benign
R3826:Col1a2 UTSW 6 4516960 unclassified probably benign
R3903:Col1a2 UTSW 6 4518822 unclassified probably benign
R3904:Col1a2 UTSW 6 4518822 unclassified probably benign
R3922:Col1a2 UTSW 6 4518822 unclassified probably benign
R3926:Col1a2 UTSW 6 4518822 unclassified probably benign
R4106:Col1a2 UTSW 6 4518822 unclassified probably benign
R4107:Col1a2 UTSW 6 4518822 unclassified probably benign
R4108:Col1a2 UTSW 6 4518822 unclassified probably benign
R4109:Col1a2 UTSW 6 4510705 nonsense probably null
R4509:Col1a2 UTSW 6 4518822 unclassified probably benign
R4667:Col1a2 UTSW 6 4512412 missense unknown
R4909:Col1a2 UTSW 6 4529058 splice site probably benign
R5418:Col1a2 UTSW 6 4516931 unclassified probably benign
R5587:Col1a2 UTSW 6 4540531 missense unknown
R5598:Col1a2 UTSW 6 4516916 unclassified probably benign
R5673:Col1a2 UTSW 6 4539622 missense unknown
R5678:Col1a2 UTSW 6 4536239 missense unknown
R5763:Col1a2 UTSW 6 4515682 missense unknown
R5786:Col1a2 UTSW 6 4530223 missense unknown
R5872:Col1a2 UTSW 6 4531926 missense unknown
R6084:Col1a2 UTSW 6 4505840 start codon destroyed probably benign 0.01
R6134:Col1a2 UTSW 6 4538035 missense unknown
R6221:Col1a2 UTSW 6 4539490 missense unknown
R6481:Col1a2 UTSW 6 4538680 missense unknown
R6500:Col1a2 UTSW 6 4515517 missense unknown
R6890:Col1a2 UTSW 6 4539587 missense unknown
R7022:Col1a2 UTSW 6 4534639 missense unknown
R7033:Col1a2 UTSW 6 4516904 unclassified probably benign
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
X0017:Col1a2 UTSW 6 4515675 missense unknown
Predicted Primers PCR Primer
(F):5'- AATGGAACTCCAGGTCAAGCAGTG -3'
(R):5'- ACTCGCCAGTGTCAGGACTTACAG -3'

Sequencing Primer
(F):5'- TGAGTATTGACCAATCCACTGGC -3'
(R):5'- TCAGGACTTACAGCAGGGC -3'
Posted On2013-05-09