Incidental Mutation 'R1026:Alyref'
List |< first << previous [record 94 of 1871] next >> last >|
ID94989
Institutional Source Beutler Lab
Gene Symbol Alyref
Ensembl Gene ENSMUSG00000025134
Gene NameAly/REF export factor
SynonymsREF1, Thoc4, Refbp1
MMRRC Submission 039128-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1026 (G1)
Quality Score223
Status Not validated
Chromosome11
Chromosomal Location120592121-120598365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 120595932 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 168 (V168L)
Ref Sequence ENSEMBL: ENSMUSP00000026125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026125] [ENSMUST00000026128] [ENSMUST00000093140]
PDB Structure
SOLUTION STRUCTURE OF THE NUCLEAR FACTOR ALY RBD DOMAIN [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000026125
AA Change: V168L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026125
Gene: ENSMUSG00000025134
AA Change: V168L

DomainStartEndE-ValueType
low complexity region 16 53 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
RRM 106 178 7.64e-20 SMART
FoP_duplication 187 255 1.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026128
SMART Domains Protein: ENSMUSP00000026128
Gene: ENSMUSG00000025135

DomainStartEndE-ValueType
RING 23 76 4.48e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093140
SMART Domains Protein: ENSMUSP00000097714
Gene: ENSMUSG00000025135

DomainStartEndE-ValueType
RING 23 76 4.48e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156685
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc42bpg T C 19: 6,317,187 C919R probably damaging Het
Cgnl1 A G 9: 71,717,431 S620P possibly damaging Het
Fbxw10 A G 11: 62,875,171 T756A probably benign Het
Fsip2 T C 2: 82,988,461 I4846T possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Map4k5 T C 12: 69,874,288 K52R possibly damaging Het
Neb T A 2: 52,264,110 M2330L possibly damaging Het
Olfr1053 T C 2: 86,315,214 Q24R possibly damaging Het
Olfr304 T A 7: 86,386,259 M134L probably damaging Het
Plekhf1 C A 7: 38,221,641 A168S probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Prss23 T A 7: 89,509,958 Y301F probably benign Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Zcchc17 C T 4: 130,329,610 V128I possibly damaging Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Other mutations in Alyref
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Alyref APN 11 120595936 missense possibly damaging 0.87
IGL02210:Alyref APN 11 120597673 missense possibly damaging 0.78
IGL02372:Alyref APN 11 120594875
IGL02424:Alyref APN 11 120595307 missense probably benign 0.07
IGL03102:Alyref APN 11 120597765 missense possibly damaging 0.65
R0234:Alyref UTSW 11 120598307 missense probably damaging 1.00
R1025:Alyref UTSW 11 120595932 missense probably damaging 0.97
R1951:Alyref UTSW 11 120595932 missense probably damaging 0.97
R1952:Alyref UTSW 11 120595932 missense probably damaging 0.97
R4591:Alyref UTSW 11 120595973 missense probably benign 0.23
R4905:Alyref UTSW 11 120596053 unclassified probably null
R5116:Alyref UTSW 11 120597728 missense probably benign 0.06
R6450:Alyref UTSW 11 120596046 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCACAAGAGGTTGGTCCAGATG -3'
(R):5'- TGGACAGTAACCCAGTTGTTCGC -3'

Sequencing Primer
(F):5'- CCAGATGTGTGGGGCAG -3'
(R):5'- GGCTGTCAGTCAAGTACCTCTAAAG -3'
Posted On2014-01-05