Mutagenetix > Incidental Mutation

Incidental Mutation 'R1219:Zfp36l2'

99965

Institutional Source

Beutler Lab

Gene Symbol

Zfp36l2

Ensembl Gene

ENSMUSG00000045817

Gene Name

zinc finger protein 36, C3H type-like 2

Synonyms

ERF2, Brf2, Tis11d

MMRRC Submission

039288-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.856) question?

Stock #

R1219 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84491359-84495375 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 84495070 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000050820 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047524] [ENSMUST00000060366]

AlphaFold

P23949

Predicted Effect

probably benign
Transcript: ENSMUST00000047524

SMART Domains

Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	457	926	3e-6	SMART
Pfam:DUF2428	938	1239	1.6e-93	PFAM
SCOP:d1gw5a_	1343	1802	7e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000060366

SMART Domains

Protein: ENSMUSP00000050820
Gene: ENSMUSG00000045817

Domain	Start	End	E-Value	Type
Pfam:Tis11B_N	1	144	1.5e-43	PFAM
ZnF_C3H1	155	182	9.8e-9	SMART
ZnF_C3H1	193	220	2.1e-8	SMART
low complexity region	223	235	N/A	INTRINSIC
low complexity region	286	340	N/A	INTRINSIC
low complexity region	345	364	N/A	INTRINSIC
low complexity region	401	418	N/A	INTRINSIC
low complexity region	436	470	N/A	INTRINSIC

Meta Mutation Damage Score

0.9502

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TIS11 family of early response genes. Family members are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice expressing decreased levels of an amino-terminal truncated protein display female infertility whereas mice homozygous for a null allele die within two weeks as a result of hematopoietic system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atad2	A	G	15: 57,998,307 (GRCm39)	S22P	probably benign	Het
Atrn	A	T	2: 130,862,927 (GRCm39)	T1336S	possibly damaging	Het
Bltp1	T	A	3: 37,000,619 (GRCm39)	L1266*	probably null	Het
Car9	G	T	4: 43,512,439 (GRCm39)		probably null	Het
Ccdc113	T	C	8: 96,264,895 (GRCm39)		probably benign	Het
Ccdc158	A	G	5: 92,802,040 (GRCm39)		probably benign	Het
Ciao3	T	C	17: 25,994,075 (GRCm39)	I41T	probably damaging	Het
Dcun1d3	G	T	7: 119,458,631 (GRCm39)	Q135K	probably damaging	Het
Dnah7b	A	C	1: 46,379,280 (GRCm39)	E3671D	probably benign	Het
Eea1	A	G	10: 95,846,623 (GRCm39)		probably benign	Het
Entrep3	T	C	3: 89,091,155 (GRCm39)	V42A	probably damaging	Het
Gdf10	G	A	14: 33,654,710 (GRCm39)	A406T	probably benign	Het
Gm5111	A	G	6: 48,567,328 (GRCm39)		probably benign	Het
Golga3	G	T	5: 110,332,215 (GRCm39)	E50*	probably null	Het
Junb	T	C	8: 85,704,268 (GRCm39)	E264G	probably damaging	Het
Kash5	A	G	7: 44,838,832 (GRCm39)		probably benign	Het
Kifc1	G	A	17: 34,103,685 (GRCm39)	R195C	probably benign	Het
Krt18	T	C	15: 101,939,723 (GRCm39)		probably benign	Het
Man1a	G	A	10: 53,795,249 (GRCm39)		probably benign	Het
Mapkbp1	G	T	2: 119,849,831 (GRCm39)	G768*	probably null	Het
Mybpc2	A	C	7: 44,165,458 (GRCm39)		probably null	Het
Nectin3	A	T	16: 46,275,042 (GRCm39)	C238*	probably null	Het
Ntf3	G	T	6: 126,079,174 (GRCm39)	R98S	possibly damaging	Het
Nup153	T	G	13: 46,840,695 (GRCm39)	Q971P	probably benign	Het
Nup155	A	G	15: 8,146,822 (GRCm39)	T221A	possibly damaging	Het
Ppp2r1b	T	C	9: 50,778,621 (GRCm39)		probably benign	Het
Prkd1	A	T	12: 50,435,125 (GRCm39)	V534E	probably damaging	Het
Rabep2	A	G	7: 126,028,799 (GRCm39)	E26G	probably damaging	Het
Rnf213	C	A	11: 119,327,003 (GRCm39)	N1663K	probably damaging	Het
Slc1a1	G	A	19: 28,882,146 (GRCm39)		probably benign	Het
Slc36a4	T	C	9: 15,634,832 (GRCm39)	Y125H	probably damaging	Het
Slc6a11	G	A	6: 114,202,772 (GRCm39)		probably benign	Het
Stab1	C	T	14: 30,862,578 (GRCm39)		probably null	Het
Sumf2	G	T	5: 129,883,613 (GRCm39)	A164S	probably benign	Het
Sv2b	T	C	7: 74,786,160 (GRCm39)	D420G	probably benign	Het
Ube2v1	T	C	2: 167,459,831 (GRCm39)	D56G	probably benign	Het
Ung	A	G	5: 114,270,228 (GRCm39)		probably benign	Het
Vcan	T	C	13: 89,828,023 (GRCm39)	Y2181C	probably damaging	Het
Vmn1r238	G	A	18: 3,123,135 (GRCm39)	T93I	possibly damaging	Het
Vmn2r14	A	C	5: 109,372,440 (GRCm39)	S17A	probably benign	Het
Vmn2r25	A	G	6: 123,816,282 (GRCm39)	V433A	probably benign	Het
Zfp646	G	A	7: 127,482,292 (GRCm39)	G1490S	probably benign	Het
Zfp839	A	G	12: 110,834,707 (GRCm39)	D654G	possibly damaging	Het

Other mutations in Zfp36l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1918:Zfp36l2	UTSW	17	84,494,164 (GRCm39)	missense	probably damaging	0.98
R2126:Zfp36l2	UTSW	17	84,494,403 (GRCm39)	missense	probably damaging	0.99
R4727:Zfp36l2	UTSW	17	84,495,089 (GRCm39)	missense	probably benign	0.07
R4915:Zfp36l2	UTSW	17	84,493,690 (GRCm39)	unclassified	probably benign
R6213:Zfp36l2	UTSW	17	84,493,980 (GRCm39)	missense	probably damaging	0.98
R6814:Zfp36l2	UTSW	17	84,493,521 (GRCm39)	unclassified	probably benign
R7011:Zfp36l2	UTSW	17	84,493,861 (GRCm39)	missense	possibly damaging	0.61
R7455:Zfp36l2	UTSW	17	84,494,575 (GRCm39)	missense	probably damaging	0.99
R7706:Zfp36l2	UTSW	17	84,494,346 (GRCm39)	missense	probably benign	0.19
R7936:Zfp36l2	UTSW	17	84,495,090 (GRCm39)	missense	probably benign	0.16
R7969:Zfp36l2	UTSW	17	84,493,252 (GRCm39)	missense	unknown
R8163:Zfp36l2	UTSW	17	84,494,551 (GRCm39)	missense	possibly damaging	0.91
R8296:Zfp36l2	UTSW	17	84,494,552 (GRCm39)	missense	probably damaging	0.99
R9634:Zfp36l2	UTSW	17	84,494,056 (GRCm39)	missense	probably damaging	1.00
R9700:Zfp36l2	UTSW	17	84,494,184 (GRCm39)	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGTCGCAAGCACACAGTCCTGC -3'
(R):5'- TCAGGTCTCCGAGTTCCACCAGTC -3'

Sequencing Primer
(F):5'- GCTAACTCCAGGACTTCCC -3'
(R):5'- TTCCACCAGTCCGCGAG -3'

Posted On

2014-01-15