Phenotypic Mutation 'macadamias' (pdf version)
Allelemacadamias
Mutation Type nonsense
Chromosome3
Coordinate94,397,302 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Rorc
Gene Name RAR-related orphan receptor gamma
Synonym(s) Thor, thymus orphan receptor, RORgamma
Chromosomal Location 94,372,794-94,398,276 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of peripheral and mesenteric lymph nodes and Peyer's patches, reduced numbers of thymocytes, and increased apoptosis with loss of thymic expression of anti-apoptosic factor Bcl-xL. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011281, NM_001293734; MGI:104856

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000029795] [ENSMUSP00000143763] [ENSMUSP00000143610]
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150
AA Change: Y500*

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150
AA Change: Y479*

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150
AA Change: Y331*

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Predicted Effect probably null
Meta Mutation Damage Score 0.6372 question?
Is this an essential gene? Probably essential (E-score: 0.828) question?
Phenotypic Category
Phenotypequestion? Literature verified References
IgE response to a Cysteine Protease (Papain) - increased
T-dependent humoral response defect- decreased antibody response to rSFV
Candidate Explorer Status CE: excellent candidate; human score: 0; ML prob: 0.756
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(7) : Chemically induced (ENU)(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Rorc APN 3 94388787 missense probably damaging 1.00
beto UTSW 3 94377608 splice site probably null
cashew UTSW 3 94391153 missense probably damaging 1.00
chestnut UTSW 3 94377609 splice site probably benign
macadamias2 UTSW 3 94387193 missense probably damaging 1.00
R0014:Rorc UTSW 3 94377613 splice site probably benign
R0115:Rorc UTSW 3 94377609 splice site probably benign
R0365:Rorc UTSW 3 94388762 missense probably damaging 1.00
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1914:Rorc UTSW 3 94391173 missense probably damaging 1.00
R1915:Rorc UTSW 3 94391173 missense probably damaging 1.00
R2142:Rorc UTSW 3 94389526 missense probably benign 0.04
R2510:Rorc UTSW 3 94389120 missense probably benign 0.30
R4135:Rorc UTSW 3 94389519 missense probably damaging 1.00
R4181:Rorc UTSW 3 94387193 missense probably damaging 1.00
R4574:Rorc UTSW 3 94388984 missense probably benign 0.00
R4701:Rorc UTSW 3 94391710 missense probably null 1.00
R5014:Rorc UTSW 3 94391153 missense probably damaging 1.00
R5233:Rorc UTSW 3 94397325 missense probably benign 0.26
R6758:Rorc UTSW 3 94387518 missense possibly damaging 0.90
R7069:Rorc UTSW 3 94372907 nonsense probably null
R7162:Rorc UTSW 3 94377608 splice site probably null
R7169:Rorc UTSW 3 94389180 missense probably benign 0.00
X0063:Rorc UTSW 3 94391751 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038157-MU
Last Updated 2019-09-04 9:47 PM by Diantha La Vine
Record Created 2014-12-19 12:03 PM by Jin Huk Choi
Record Posted 2015-01-28
Phenotypic Description

Figure 1. Macadamias mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The macadamias phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1470, some of which showed a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent antibody response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 145 mutations (X-axis) identified in the G1 male of pedigree R1470.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 145 mutations.  The reduced T-dependent antibody response to rSFV-β-gal was linked by continuous variable mapping to a mutation in Rorc:  a T to A transversion at base pair 94,397,302 (v38) on chromosome 3, or base pair 24,587 in the GenBank genomic region NC_000069.  Linkage was found with a recessive model of inheritance (P = 8.697 x 10-8), wherein 4 variant homozygotes departed phenotypically from 8 homozygous reference mice and 11 heterozygous mice (Figure 2).  A substantial semidominant effect was observed but the mutation is preponderantly recessive.  The mutation corresponds to residue 1,598 in the mRNA sequence NM_011281 within exon 11 of 11 total exons.

 
1581 GCCTTCCCTCCACTCTATAAGGAACTCTTCAGC
495  -A--F--P--P--L--Y--K--E--L--F--S

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 500 for a premature stop codon (Y500*) in the RAR-related orphan receptor gamma (RORγ) protein.

Protein Prediction

Figure 3. Rorc encodes two isoforms. (A) The genomic organization of Rorc. Exons are labeled with their isoform-specific numbers (γ1, RORγ1; γt, RORγt). The first exon of the RORγt isoform is colored red.  (B) Domain organization of mouse RORγt and RORγ1.  The macadamias mutation mutation is a premature stop codon at residue 500 in the RORγ1 isoform. DBD, DNA binding domain; CTE, carboxy-terminal extension; LBD, ligand binding domain.

RAR-related orphan receptor gamma (RORγ) is a member of the RAR-related orphan nuclear hormone receptor transcription factor family. RORγ has an N-terminal domain (A/B region), a DNA-binding domain (DBD), a hinge domain, and a C-terminal ligand-binding domain (LBD) [Figure 3; reviewed in (1)]. Rorc generates two isoforms of RORγ, RORγ1 and RORγt (alternatively, RORγ2), by the use of alternative promoters and/or by alternative splicing of a common pre-mRNA (2;3). The RORγ isoforms have the same DBDs and LBDs, but RORγt lacks the N-terminal 24 amino acids of RORγ1 encoded by the first two exons of Rorc and has three alternative residues encoded by the first exon specific to RORγt [Figure 3; (2;3)].

 

The macadamias mutation results in substitution of Tyr500 for a premature stop codon in the RORγ1 isoform as well as a substitution of Tyr497 for a premature stop codon in the RORγt isoform. The mutated residue in both isoforms is within an undefined domain after the LBD (SMART). Protein expression and localization of RORγmacadamias has not been examined.

 

Please see the record for chestnut for more information about Rorc.

Putative Mechanism

RORγ has well documented functions including to negatively regulate CD4+CD8+ double positive (DP) thymocyte apoptosis to promote cell survival [(4;5); reviewed in (6)]. In addition, RORγ inhibits expression of Fas ligand (FasL) and interleukin-2 (IL-2), protecting hybridomas from TCR-induced apoptosis [(2;7); reviewed in (6)]. RORγt promotes TGF-β plus IL-6- or IL-21-induced TH17 differentiation and suppress TNF- and IL-1β-induced TH1 and TH2 differentiation (8-11). Rorc-/- mice do not have lymph nodes (both peripheral and mesenteric) as well as Peyer’s patches due to the absence of lymphoid tissue inducer (LTi) cells, which require RORγt for their generation and survival through the regulation of Bcl-xL (4;5;12;13). Studies have shown conflicting results on the splenic structure of Rorc-/- mice (MGI:2384142). Sun et al. reported no change in splenic structure (4), while Zhang et al. reported enlarged spleens due to an accumulation of conventional resting B cells; B lymphocyte development in the bone marrow and spleen in the Rorc-/- mice were normal and B cell levels in the blood were comparable to controls (13).

 

Significant changes in the frequency of T and B cells were not observed in macadamias. However, the deficiency of the macadamias mice to mount a T-dependent antibody response to rSFV-β-gal indicates that RORγmacadamias has reduced and/or altered function compared to the wild-type protein.

Primers PCR Primer
macadamias_pcr_F: TGGCTGCTCAAGTTGGGTCAAG
macadamias_pcr_R: GCTGCTGTTGTCCTACAAGGCAAG

Sequencing Primer
macadamias_seq_F: GGTCATCCTAGCTCAGTAACAGTG
macadamias_seq_R: TAGGGGCAGAAAATCAGTCTTAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 457 nucleotides is amplified (chromosome 3, + strand):


1   tggctgctca agttgggtca agggtcgggg aggcatcaag aagggtcatc ctagctcagt
61  aacagtgaga tgtgtttgct ctgctaagca ccgaagtact cattccctcc taacctatcc
121 tcagctgcca cccaaaggaa aactccggag cctgtgcagc caacatgtgg aaaagctgca
181 gatcttccag cacctccacc ccatcgtggt ccaagccgcc ttccctccac tctataagga
241 actcttcagc actgatgttg aatcccctga ggggctgtca aagtgatctg gaggaaggac
301 aactttctat ttccttcagc cctctgaccc gtctccctgg actcccttca cccagccttt
361 ccctttctgc actctatgaa gggtggtatc cctaggagta agcaaatcct aagactgatt
421 ttctgcccct aggcttgcct tgtaggacaa cagcagc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Apiruck Watthanasurorot, Bruce Beutler