Phenotypic Mutation 'wobbley' (pdf version)
List |< first << previous [record 569 of 584] next >> last >|
Allelewobbley
Mutation Type critical splice donor site (2 bp from exon)
Chromosome10
Coordinate81,220,573 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Atcay
Gene Name ataxia, cerebellar, Cayman type homolog (human)
Synonym(s) 3322401A10Rik, ji, BNIP-H
Chromosomal Location 81,204,508-81,230,833 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuron-restricted protein that contains a CRAL-TRIO motif common to proteins that bind small lipophilic molecules. Mutations in this gene are associated with cerebellar ataxia, Cayman type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants homozygous for a severe allele show progressive impaired coordination and seizures beginning by 10-16 days of age and die by 4 weeks of age. Homozygotes for milder alleles have abnormal gait, slightly diminished body size and reduced male fertility. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_178662; MGI: 2448730

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000036721 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:BNIP2 59 191 1.3e-45 PFAM
Pfam:CRAL_TRIO 211 318 2.1e-5 PFAM
low complexity region 352 369 N/A INTRINSIC
Phenotypic Category Autosomal Recessive
Penetrance 100% 
Alleles Listed at MGI
All alleles(6) : Gene trapped(1) Spontaneous(4) Chemically induced(1)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:Atcay APN 10 81210548 missense probably damaging 1.00
IGL03493:Atcay APN 10 81210573 nonsense probably null
R0040:Atcay UTSW 10 81210519 splice donor site probably benign
R0040:Atcay UTSW 10 81210519 splice site probably benign
R0113:Atcay UTSW 10 81214720 critical splice donor site probably null
R0441:Atcay UTSW 10 81224460 missense possibly damaging 0.71
R1655:Atcay UTSW 10 81213397 missense probably damaging 1.00
R1709:Atcay UTSW 10 81213231 missense probably damaging 1.00
R1955:Atcay UTSW 10 81214793 missense possibly damaging 0.95
R1968:Atcay UTSW 10 81212478 missense possibly damaging 0.65
R2298:Atcay UTSW 10 81210563 missense probably damaging 1.00
R4472:Atcay UTSW 10 81212527 missense possibly damaging 0.78
R6265:Atcay UTSW 10 81213280 missense possibly damaging 0.94
R6322:Atcay UTSW 10 81213291 missense probably damaging 0.98
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 030219-UCD
Last Updated 2018-05-22 9:47 AM by Anne Murray
Record Created unknown
Record Posted 2008-06-26
Phenotypic Description

The wobbley phenotype was identified as an ENU-induced G3 visible mutant.  Wobbley mice exhibit an abnormal gait, lifting their hind legs higher than usual when taking steps.  Wobbley mice fall frequently on their backs and then have difficulty righting themselves.  These phenotypes are observable by weaning age, but adolescents are otherwise healthy, able to breed and have normal eating behavior.  However, phenotypes are progressive, and mutants become unable to eat by eight months of age.

Nature of Mutation
The wobbley mutation is a T to A transversion in the donor splice site of intron 4 (GTAATG -> GAAATG) in the Atcay gene on chromosome 10 (position 16060 in Genbank genomic region NC_000076 for linear genomic DNA sequence of Atcay).  Although the consequence of the mutation at the cDNA level has not been determined, the mutation may result in skipping of the 222-nucleotide exon 4 (out of 13 total exons), which would maintain the reading frame but delete amino acids 46-119, and replace the first amino acid of exon 5, an aspartic acid, with a tyrosine.
 
       <--exon 3   <--exon 4 intron 4--> exon 5--> <--exon 13
11617 GACTCCTCCT……GAGTGGGAAGGTAATGGCC…………ATGACACCC……ATGTCCTGA 23266
43   --D--S--S-……--E--W--E-              Y--D--T…………-M--S--*- 298
      correct     deleted                normal(except for the Y)
 
The donor splice site of intron 4, which is destroyed by the wobbley mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.
Protein Prediction

Figure 1.  Domain structure of mouse Caytaxin.  The wobbley mutation is a T to A transversion occurring in the donor splice site of intron 4 of Atcay (shown with a red asterisk); the mutation may result in the destruction of exon 4.  The conserved C-terminus contains two BCH (BNIP-2 and Cdc42GAP homology) domains.  One BCH domain is shared with a CRAL-TRIO motif, named for cellular retinal (CRAL) and the TRIO guanine exchange factor.

The Atcay gene encodes the 372 amino acid Caytaxin (or BNIP-H) with the mouse and rat proteins showing 93% and 91% identity to the human protein, respectively (Figure 1) (1;2).  Caytaxin shows similarities to a few other proteins including BCL2/adenovirus E1B interacting protein 2 (BNIP-2) and KIAA0367 (also known as BMCC1 for BCH motif-containing molecule at the C-terminal region 1) (1;2).  Members of the BNIP protein family can interact with small GTPases like Cdc42, Rac1 and RhoA through a protein-protein interaction domain known as the BCH (BNIP-2 and Cdc42GAP homology) domain, and are considered to be GTPase activating proteins (GAPs) (3;4) (see moonlight for more discussion of GTPases).  This domain is predicted to fold into α-helical bundles similar to the topology of the catalytic GAP domain of Cdc42GAP (3).  The BCH domain in caytaxin spans amino acids 190-371, and has been shown to bind to kidney-type glutaminase (KGA; see Background and Putative Mechanism) at two different sites, Site I (residues 191-235) and Site II (residues 288-331) (5).
 

A portion of the BCH domain in caytaxin has weak homology to the yeast phosphatidylinositol/phosphatidylcholine transfer protein SEC14 protein in the C-terminal domain (amino acids 180 to 330 in caytaxin) (1;6).  This domain contains a CRAL-TRIO motif common to proteins that bind small lipophilic molecules, and is named after cellular retinal (CRAL) and the TRIO guanine exchange factor.  Mutation of another protein containing a CRAL-TRIO domain, Tocopherol transfer protein alpha (TTPA), which transports vitamin E, causes the rare Friedreich-like ataxia with selective vitamin E deficiency (OMIM #277460), which responds to large doses of vitamin E (7).  Comparison of a 3-dimensional model of caytaxin with that of TTPA suggested that the ligand-binding pocket of caytaxin is more polar than that of TTPA (1).  The N-terminal region of caytaxin is highly acidic, but contains no known domains.

 
The wobbley mutation may delete exon 4 of the Atcay gene, resulting in deletion of amino acids 46-119 in the N-terminus of caytaxin.  This does not delete any known domains, and retains the conserved C-terminal region.  It is unknown if the mutant version of the caytaxin protein is expressed appropriately. 
Expression/Localization
In mice, northern blot analysis of Atcay showed strong expression restricted to the brain with three main transcripts owing to different polyadenylation sites (1).  In situ hybridization to adult mouse brain showed strong expression in most of the brain, including cortex, cerebellum and olfactory bulbs.  In situ hybridization in embryonic day (E)16 embryos showed mRNA restricted to neuronal tissues, including brain, dorsal root ganglia and enteric nervous system.  Western blot and immunohistochemistry studies confirmed these results, but levels of caytaxin protein increased between postnatal day (P)7 and P14, while mRNA levels remained the same.  Protein levels were especially high in the cerebellum and hippocampus.  Caytaxin protein was localized to the presynaptic cytosol (8).
 
In rats (2), similar results were found.  Atcay transcripts were present on E15, P1, P7, P14, P36 and 8 months.  However, from E15 to P14, the relative proportion of the smallest transcript (1.8 kb) was increased. QRT-PCR found Atcay transcript levels peaking at P7 in hippocampus, increasing linearly from P1 to P36 in cerebellum, and showed minimal developmental regulation in cerebral cortex.  All neuronal populations express the gene.  At E15, Atcay transcript was noted in dorsal root and peripheral ganglia, similar to the expression in the mouse.  In cerebellum, Atcay transcript was present in the molecular, Purkinje and granular layers with transcripts peaking in the molecular layer at P14, consistent with a role in cerebellum maturation.
Background

Table 1. Summary and comparison of Atcay mutation models. Please see the text for further details. Table modified from (2).

FIgure 2. Schematic diagram of neuronal connections in the cerebellum. Control of movement is largely determined by incoming (afferent) and outgoing (efferent) neural impulses in the cerebellum. Motor information input travels from the spinal cord, cerebral cortex and vestibular system via mossy fibers. Feedback regarding movements returns to the cerebellum via the inferior olivary nucleus in the medulla oblongata. This feedback loop allows the brain to coordinate movement. All outgoing neural impulses from the cerebellum travel via the deep cerebellar and vestibular nuclei. Proper functioning of the neuronal pathway between mossy fibers, granular cells, parallel fibers, climbing fibers and Purkinje cells are thought to be essential for coordinated muscular movement. Glutamate is a neurotransmitter in the excitatory synapses between climbing fibers and Purkinje cells as well as between granular cells and mossy fibers. Disruptions in this system are thought to be involved in a variety of movement disorders (e.g. dystonia and ataxia present as a result in disruptions in the output signals). For simplicity the diagram does not include other neurons in the cerebellum such as Golgi cells, stellate cells, and basket cells.  Adapted from: Apps, R. and Garwicz, Nature Reviews, 2005, Vol. 6.

In humans, mutations in the ATCAY gene can cause Cayman cerebellar ataxia (OMIM #601238), which is characterized by marked psychomotor retardation and prominent nonprogressive cerebellar dysfunction including nystagmus, intention tremor, dysarthria (motor speech disorder), and ataxia (uncoordinated movements) (9).  Hypotonia is present from early childhood, and imaging studies show cerebellar hypoplasia in individuals presenting with Cayman cerebellar ataxia (1).  Two mutations causing this disease in humans have been identified; a homozygous C-to-G change in exon 9, predicting a serine-to-arginine substitution at amino acid 301 in the BCH domain, and a homozygous G-to-T substitution in the third base of intron 9.  The mutated serine is conserved between human and rodent sequences but not across all BNIP family members, and is not predicted to interfere with the protein folding, based on 3-D modeling.  Analysis of the splice mutation predicts aberrant splicing resulting in a truncated protein lacking most of the conserved C-terminal domain, but some normal splicing may occur.
 
Several mouse phenotypes result from mutations in the Atcay gene (Table 1).  The jittery mouse is a recessive mutation characterized by progressive ataxic gait, dystonic movements (see below), spontaneous seizures, and early death by dehydration/starvation.  Animals can be recognized by P12-15 due to their smaller size and abnormal movements with death occurring between 20-40 days.  The allelic hesitant mutant is viable and can breed, but is characterized by hesitant, uncoordinated movements, exaggerated stepping of the hind limbs and reduced male fertility (10).  Another allele, sidewinder, has phenotypes similar to those observed in jittery mice.  The Atcay mutation in hesitant mice is caused by an intracisternal A-particle (IAP) element insertion in intron 1 that results in production of abnormal transcript.  A diminished amount of normal transcript is produced in hesitant mice explaining the mild phenotype of this mutant.  The Atcay mutation in jittery mice is caused by a retrotransposon B1 insertion into exon 4.  Jittery mutants have less mRNA than hesitant animals, and transcript is predominantly abnormal.  The B1 element insertion predicts a truncated protein of 62 normal residues plus 21 missense residues, instead of the normal 327 amino acids.  Jittery mice also express a minor mRNA product in which the mutated exon 4 is skipped, restoring the reading frame.  This transcript results in a deletion of 74 amino acids from the protein (the same residues deleted in wobbley) and a D → Y substitution.  The Atcay mutation in sidewinder animals is caused by a 2-bp deletion in exon 5.  It is predicted to produce a truncated protein of 181 amino acids plus 19 missense residues (1).
 
The genetically dystonic (dt) rat is an autosomal recessive model of generalized dystonia caused by the insertion of a 3’-long terminal repeat (3’-LTR) of a rat IAP element into intron 1 of the rat Atcay gene (2).  Dystonia is a motor abnormality marked by sustained muscle contractions, frequently causing twisting and repetitive movements or abnormal postures.  In humans, dystonia is a common feature of many neurological diseases,and can be caused by mutations in many genes, especially those involved in dopaminergic pathways or ATP-binding.  These include genes encoding GTP cyclohydrolase 1, tyrosine hydroxylase (Dystonia dopa-responsive; OMIM #128230), the alpha-3 subunit of the N,K-ATPase (ATP1A3) (Dystonia 12; OMIM #128235), and the ATP-binding protein torsin-A (Dystonia 1;OMIM #128100) (11-14)
 
Although the Atcay mutation in dt rats is similar to the one seen in hesitant mice (1;2), dt rats display severe symptoms and express very low levels of Atcay transcript and the protein product caytaxin (2).  Symptoms are evident by P12 and progress in severity until death by P40.  Removal of the cerebellum extends life (15).  Gross brain morphology is normal, but the cerebellar Purkinje cells, which are a class of gamma-aminobutyric (GABA)ergic neurons important in motor coordination, are smaller in dt rats than normal littermates and respond abnormally to climbing fiber input from olivocerebellar pathways(6;16;17).  These results, as well as the neurological dysfunction and cerebellar atrophy observed in Cayman cerebellar ataxia in humans, strongly suggest that caytaxin deficiency primarily affects the cerebellum (1;15;16), and may be involved in cerebellum maturation based on expression data (2;8).  Abnormal Purkinje cell function results in abnormal cerebellar output resulting in dystonia and ataxia (Figure 2).   
 

In genetically dystonic rats, significant up-regulation of corticotrophin releasing hormone receptor 1 (CRH-R1) and plasma membrane calcium ATPase 4 (PMCA4) was detected in Purkinje cells and parallel fibers, respectively (6).  CRH, along with other transmitters, is released at climbing fiber synapses (18), and long-term depression (LTD) at the parallel fiber-Purkinje cell synapse may require CRH released by climbing fibers (19).   LTD also requires post-synaptic calcium elevation, activation of group 1 metabotropic glutamate receptors and protein kinase C (20).  Increased expression of CRH-R1 may represent a compensatory response to a post-synaptic defect of Purkinje cells, while increased expression of PMCA4 may be a marker of increased synaptic activity at parallel fiber synapses on Purkinje cells.  PMCAs hydrolyze ATP in the process of translocating calcium from the cytosol.  Besides PMCA4, several other genes encoding proteins involved in calcium homeostasis were up-regulated in the dt rat.  Defects in Purkinje cell calcium homeostasis appears to be common to most rodent models of dystonia (6;21).

 
Other work has identified a number of potential binding partners for caytaxin.  A proteomic screen found that caytaxin interacts with the carboxyl terminus of Hsp70-interacting protein (CHIP), which was found to efficiently polyubiquitinate caytaxin in vitro, suggesting that it might influence caytaxin degradation in vivo (22).  Kidney-type glutaminase (KGA), which converts glutamine to the excitatory neurotransmitter glutamate, was also found to directly bind to caytaxin both in vitro and in vivo.  In neuronal cell culture, caytaxin overexpression relocalized KGA from the cell body to neurite terminals suggesting that caytaxin may be involved in regulating appropriate levels of glutamate in axon terminals (5).  Although members of the BNIP protein family have been shown to interact with small GTPases (3;4), caytaxin does not bind to Cdc42, Rac1 or RhoA (5).
Putative Mechanism
Examination of dysregulated genes in the genetically dystonic (dt) rat model provides some insight into the role of caytaxin in cerebellar function.  Caytaxin contains a Sec14 domain, which in yeast functions as a phosphatidylinositol transfer protein.  Therefore, caytaxin potentially binds to a phosphatidylinositol ligand.  In support of this hypothesis, genes encoding the phosphatidylinositol 4-phosphate adaptor protein 1 (Plekha3), phospholipid scramblase 3 (PLSCR3), and inositol polyphosphate phosphatase-like 1 or SH2-containing inositol phosphatase 2 (Inpp1) were upregulated in dt rat cerebellar cortex (6).  In addition, genes encoding inositol polyphosphate 1-phosphatase (INPP1), inositol polyphosphate-5-phosphatase A (INPP5A), and frequenin, which appears to bind and stimulate isoforms of phosphatidylinositol 4-kinase (23) are downregulated (6).  These data suggest caytaxin may be involved in phosphatidylinositol signaling pathways, and is consistent with data suggesting an involvement in calcium regulation as inositol-1,4,5-triphosphate (IP3) is required for calcium release in Purkinje cell dendritic spines (26) (please see record for new gray).  However, the changes in these pathways could be secondary to the abnormalities caused by a deficiency in caytaxin.  It is unclear if the C-terminal domain of caytaxin is merely a protein-protein interaction domain or if the CRAL-TRIO motif is functional as well.  Further studies need to be made to determine if caytaxin is able to bind to small lipophilic molecules.  In addition, a number of other genes are dysregulated in dt rats including some encoding proteins involved in apoptosis, protein folding and extracellular matrix interactions.  Although caytaxin has homology to BNIP-2 and similar proteins that are involved in apoptosis, no evidence of enhanced apoptosis was seen in mutant mice (1). 
 
The binding of caytaxin to KGA also provides a clue to its function in the brain (8).  The interaction of caytaxin with KGA relocalized KGA to axon terminals, suggesting that caytaxin may be involved in intracellular trafficking.  Relocalization of KGA at the axon terminals may provide an important source of glutamate at these synapses.  However, caytaxin was also shown to reduce steady-state levels of glutamate by inhibiting glutaminase activity.  These results suggest caytaxin may be important for tight regulation of glutamate levels.  Levels of glutamate that are too low or too high would lead to abnormal neurotransmission.  Abnormally high levels of glutamate in the extracellular space have been linked to neurotoxicity and cell death (24;25).  This may be the underlying cause of the reported cerebellar hypoplasia in humans with Cayman ataxia (1).  Although it appears that caytaxin binds to KGA and regulates glutamate levels, it is likely it has other binding partners (such as CHIP) and other neuronal functions.  In dt rats, abnormal function of the synaptic pathways involving the cerebellar Purkinje cells are suggested to cause disease in these animals.  However, Purkinje cells are GABAergic neurons and glutaminase is known to be absent in these cells (5). These data suggest that caytaxin has multiple roles in the brain.
 
The relatively mild phenotypes of wobbley homozygous animals suggest that the wobbley allele expresses some levels of functional protein.  Interestingly, the jittery mouse mutant has a rare transcript in which exon 4 is also deleted, resulting in the same predicted aberrant protein as that predicted by the wobbley mutation (1), although the protein is probably expressed at lower levels, which may account for the early lethality seen in jittery mice.  Since production of normal Atcay transcript occurs in viable hesitant mice, normal Atcay transcript may also be produced in wobbley mice, accounting for the similarity in phenotypes of these two alleles.  It is equally possible that the internally deleted caytaxin protein expressed in wobbley mice retains some function. 
Primers Primers cannot be located by automatic search.
Genotyping
Wobbley genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Wobb(F): 5’- GGCAGTTCTGATTCGCTGTCCAAAG -3’
Wobb(R): 5’- TGCTAAGTGAGAAGACCCTGTCCC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Wobb_seq(F): 5’- ACATGGTGGCTCACAACTATCTG -3’
Wobb_seq(R): 5’- TCCTGGTTAACAAGGCTACG -3’
 
The following sequence of 1086 nucleotides (from Genbank genomic region NC_000076 for linear DNA sequence of Atcay) is amplified:
 
15301  ggcagttct gattcgctgt ccaaagacaa aagcaaaaga gaaagaggca ggagaggagc
15361 catgaggagt cttttatata ctttttcatg ataccaacag aaaccaagat tattgcaaca
15421 ataaggaggg agctccgggc tggagagatg gctcagtggt taagagtgcc tactgctctt
15481 ccaaaggtcc tgagttcaaa tcccagcaac cacatggtgg ctcacaacta tctgtaacga
15541 aatctgatgc tctcttctgg agtgtctaaa ggcacactac agtatactta catataataa
15601 ataaataatt tttttaaaag gagggagttc cacccctgac cacaccctca atccctcact
15661 ctgggttcta ggcaggggct ggccctgggt tctgtcaccc agcacgggaa ggtggactcc
15721 aggcattcaa ggccattctc tattacatag tgagtttgag gtcatcctgg gctacatgag
15781 atgctgtcct gtggtccagg agagtgagct ctctttcttg cttgtggtcc tggcagcacc
15841 tccctccacc ctgaacttga gcggagcaca tcgaaagaga aagacgctgg tggctccaga
15901 gatcaacatc tccctggacc aaagcgaggg ctctctgctg tccgacgact tcctcgacac
15961 acctgatgac ctggacatca atgtggacga cattgagacg ccagatgaaa ctgactctct
16021 ggagttcttg ggaaatggca atgaacttga gtgggaaggt aatggccatg ctctgtcccc
16081 ctggtttcac ttagcctctt tggaccccag tggccacttc ctcactgtgg ttcccacaga
16141 tgagcgaggt ccagagggat cctatccacg gggaactaga catcaacaga aggttctagg
16201 atgggattca gttaagtacg tagccttgtt aaccaggaga tgtgtgcagg tgggactgtc
16261 cctccttttc cttccttctt gtcagcctcc cagatgccct cctgcctgga gctagctgct
16321 acagtcagac agatggacgg ccacaaatcc cagacatgag tcagggacag ggtcttctca
16381 cttagca                                                             

 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Victoria Webster
AuthorsCarrie N. Arnold, Bruce Beutler
List |< first << previous [record 569 of 584] next >> last >|
Edit History
2011-01-07 10:00 AM (current)
2010-04-09 2:26 PM
2010-04-09 2:25 PM
2010-01-18 12:00 AM