Allele | costume | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | splice site (3 bp from exon) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 86,475,248 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ C (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Pde6d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | phosphodiesterase 6D, cGMP-specific, rod, delta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 86,470,716-86,510,351 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014] PHENOTYPE: Homozygous null mice exhibit progressive retinal degeneration with progressive loss of rod and cone neurons. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000027444 †] [ENSMUSP00000137956] [ENSMUSP00000137820 †] † probably from a misspliced transcript | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | O55057 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000027444 Gene: ENSMUSG00000026239
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000137956 Gene: ENSMUSG00000026239 AA Change: T48A
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000137820 Gene: ENSMUSG00000026239
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000137820 Gene: ENSMUSG00000026239
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9755 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Possibly nonessential (E-score: 0.374) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(14) : Chemically induced (other)(1) Gene trapped(7) Radiation induced(1) Targeted(5) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:44 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2015-10-26 4:56 PM by Zhe Chen | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-02-23 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The costume phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3084, some of which showed reduced body weights compared to wild-type littermates (Figure 1). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 43 mutations. The body weight phenotype was linked to a mutation in Pde6d: an A to G transition at base pair 86,547,526 (v38) on chromosome 1, or base pair 35,283 in the GenBank genomic region NC_000067 encoding Pde6d. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 19 homozygous reference mice and 22 heterozygous mice with a P value of 1.572 x 10-6 (Figure 2). The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 89-nucleotide exon 2 (out of 5 total exons), resulting in a frame-shifted protein product beginning after amino acid 17 and coding of a premature stop codon at amino after 53 aberrant amino acids (at amino acid 70).
The donor splice site of intron 2, which is destroyed by the costume mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Pde6d encodes cGMP phosphodiesterase (PDE6δ; alternatively, PDEδ, PrBP/δ, or PDE6D), a member of the phosphodiesterase superfamily. The members of the phosphodiesterase superfamily regulate the concentrations of cAMP and cGMP in the cell (1). PDE6δ is structurally similar to Rho GTPase guanine nucleotide dissociation inhibitor (RhoGDI) and UNC119 in that it forms an immunoglobulin-like β-sandwich fold composed of two β-sheets that form a hydrophobic pocket [Figure 3 & 4; (2); reviewed in (3)]. The N-terminal region of PDE6δ is an α-helix (α1), and a short 310 helix occurs in one of the loop regions [Figure 4; (4;5); PDB: 1KSG]. One β-sheet of the immunoglobulin-like β-sandwich fold is formed by four β-strands, and the other β-sheet is formed by five β-strands (5). The loop connecting β7 and β8 is disordered. The immunoglobulin-like β-sandwich fold mediates farnesyl (C15) and geranylgeranyl (C20) lipid binding (6). The costume mutation is predicted to result in a frame-shifted protein that encodes a premature stop codon after amino acid 70. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | PDE6δ is ubiquitously expressed (3;4), but it is highly expressed in both the rods and cone photoreceptor cells of the retina (6;7). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
PDE6δ is a chaperone involved in the transport of a number of prenylated proteins (Table 1) to several sites in the cell, but predominantly in the cilia (6;8;9). Prenylation is the covalent addition of farnesyl or geranylgeranyl isoprenoids to the cysteine of a CAAX (C = cysteine, A = aliphatic amino acid, X = any amino acid) box in target cytosolic proteins through a thioether bond by cytosolic prenyl transferases (10;11). The “X” in the CAAX box determines that nature of the lipid chain; a leucine at that residue specifies geranylgeranylation, while all other residues promote farnesylation. Table 1. Known PDE6δ interacting proteins
During PDE6δ-mediated sorting of prenylated proteins, PDE6δ binds the cargo and sorts it into the appropriate cellular compartment. The high-affinity cargo is released by ARL3 in the cilia; low-affinity cargo is released by ARL2 into the entire cell. A retention signal facilitates the retention of the prenylated cargo at the appropriate location in the cell (12). Mutations in PDE6D are associated with Joubert syndrome (OMIM# #615665), a ciliopathy caused by defects in ciliary biogenesis and/or function. One such mutation in PDE6D is a null allele that causes defective trafficking of INPP5E to cilia (14). Patients with the null PDE6D mutation exhibit polydactyly, microphthalmia (i.e., developmental disorder of the eye in which one or both eyes are abnormally small and have anatomic malformations), coloboma (i.e., congenital malformation of the eye causing defects in the lens, iris, or retina), and renal hypoplasia. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Pde6d-deficient (Pde6d-/-) mice were viable and fertile, but exhibited reduced body sizes early in life (15). The Pde6d-/- mice exhibited defective transport of GRK1, cone PDE6, and Tβγ to the outer segments of rod and cone photoreceptor of the retina, which caused a slowly progressive form of retinitis pigmentosa [reviewed in (3)]. Similar to the Pde6d-/- mice, the costume mice exhibit reduced body size/weights compared to wild-type littermates indicating that PDE6δcostume is a loss-of-function allele. The costume mice have not been examined for abnormalities of the retina. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer costume_pcr_F: CTCTCTGTGCAGCTGTCAGA costume_pcr_R: AGTTCATGTCTCAGATGTTATGTAAC Sequencing Primer costume_seq_F: CTCAATCTGCAAAGTGCTGG costume_seq_R: TTAAAAACCTCTGGAGTCAGCTGG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 760 nucleotides is amplified (chromosome 1, - strand): 1 agttcatgtc tcagatgtta tgtaacatgg tgtagattaa aaacctctgg agtcagctgg Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Zhe Chen, Jianhui Wang, Ryan Solts, Noelle Hutchins, Takuma Misawa, and Bruce Beutler |