Phenotypic Mutation 'r18' (pdf version)
List |< first << previous [record 2 of 2]
Alleler18
Mutation Type small insertion
Chromosome19
Coordinate
Base Change
Gene Lrp5
Gene Name low density lipoprotein receptor-related protein 5
Synonym(s) LR3, LRP7
Chromosomal Location 3,584,828-3,686,564 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008513; MGI: 1278315

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000025856 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
EGF 603 640 2.48e-1 SMART
LY 666 708 5.92e-8 SMART
LY 709 751 5.65e-14 SMART
LY 752 795 3.81e-11 SMART
LY 796 837 3.54e-6 SMART
LY 838 877 1.33e-1 SMART
EGF 904 941 1.22e0 SMART
LY 968 1009 4.39e-2 SMART
LY 1015 1057 1.81e0 SMART
LY 1058 1102 9.47e-7 SMART
LY 1103 1145 6.91e-9 SMART
LY 1146 1186 1.53e0 SMART
EGF 1215 1253 2.85e-1 SMART
LDLa 1257 1296 1.23e-13 SMART
LDLa 1297 1333 3.26e-9 SMART
LDLa 1334 1371 1.31e-13 SMART
transmembrane domain 1384 1406 N/A INTRINSIC
low complexity region 1494 1503 N/A INTRINSIC
low complexity region 1571 1578 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
vision/eye
Penetrance 100% 
Alleles Listed at MGI

All alleles(15) : Targeted, knock-out(5) Targeted, other(4) Gene trapped(5) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Lrp5 APN 19 3649404 missense probably benign
IGL00902:Lrp5 APN 19 3600774 missense probably damaging 1.00
IGL02032:Lrp5 APN 19 3615886 splice site probably benign
IGL02331:Lrp5 APN 19 3591816 missense possibly damaging 0.64
IGL02401:Lrp5 APN 19 3593585 missense probably damaging 1.00
IGL02471:Lrp5 APN 19 3602408 missense probably benign 0.31
IGL02572:Lrp5 APN 19 3614283 missense probably benign 0.17
IGL02637:Lrp5 APN 19 3630269 missense probably benign 0.03
IGL02696:Lrp5 APN 19 3602253 missense probably benign
IGL02742:Lrp5 APN 19 3604022 missense probably damaging 0.99
IGL02804:Lrp5 APN 19 3600777 missense possibly damaging 0.63
IGL03089:Lrp5 APN 19 3620314 splice site probably null
IGL03243:Lrp5 APN 19 3630159 missense probably benign 0.12
R0219:Lrp5 UTSW 19 3597349 missense probably damaging 1.00
R0526:Lrp5 UTSW 19 3628295 missense probably damaging 1.00
R0597:Lrp5 UTSW 19 3600777 missense possibly damaging 0.63
R0883:Lrp5 UTSW 19 3605308 missense probably damaging 1.00
R1086:Lrp5 UTSW 19 3649476 missense probably benign 0.28
R1417:Lrp5 UTSW 19 3586425 missense probably benign 0.04
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1533:Lrp5 UTSW 19 3614234 missense probably benign 0.17
R1538:Lrp5 UTSW 19 3647585 missense possibly damaging 0.70
R1856:Lrp5 UTSW 19 3597346 missense probably benign 0.18
R1930:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1931:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1932:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1951:Lrp5 UTSW 19 3620298 missense possibly damaging 0.89
R2016:Lrp5 UTSW 19 3610056 missense probably benign 0.04
R2131:Lrp5 UTSW 19 3622708 missense possibly damaging 0.87
R2153:Lrp5 UTSW 19 3614339 missense probably benign 0.22
R2403:Lrp5 UTSW 19 3597430 missense probably damaging 1.00
R3158:Lrp5 UTSW 19 3615849 missense probably damaging 0.97
R3771:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3772:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3773:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3825:Lrp5 UTSW 19 3605290 nonsense probably null
R3887:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3888:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3893:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3917:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R4279:Lrp5 UTSW 19 3591778 missense possibly damaging 0.94
R4714:Lrp5 UTSW 19 3659454 missense probably damaging 1.00
R4825:Lrp5 UTSW 19 3614292 missense probably damaging 1.00
R5102:Lrp5 UTSW 19 3659304 missense probably damaging 0.96
R5138:Lrp5 UTSW 19 3628319 missense probably benign 0.03
R5497:Lrp5 UTSW 19 3602319 missense probably damaging 1.00
R5632:Lrp5 UTSW 19 3622512 missense probably benign
R5887:Lrp5 UTSW 19 3604094 missense probably benign 0.01
R5950:Lrp5 UTSW 19 3602333 missense probably benign 0.17
R5987:Lrp5 UTSW 19 3628299 missense probably damaging 1.00
R6080:Lrp5 UTSW 19 3628316 missense probably benign 0.32
R6181:Lrp5 UTSW 19 3628427 missense probably damaging 1.00
R6236:Lrp5 UTSW 19 3630483 splice site probably null
R6332:Lrp5 UTSW 19 3659355 missense probably damaging 1.00
R6511:Lrp5 UTSW 19 3652296 missense probably damaging 1.00
R6641:Lrp5 UTSW 19 3652287 missense probably damaging 1.00
R6791:Lrp5 UTSW 19 3600753 missense probably damaging 1.00
R6865:Lrp5 UTSW 19 3620013 critical splice donor site probably null
R6906:Lrp5 UTSW 19 3622638 missense probably damaging 1.00
R6922:Lrp5 UTSW 19 3605301 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock None
Repository

MMRRC: 030412-UCD

Last Updated 2017-03-24 8:25 AM by Katherine Timer
Record Created unknown
Record Posted 2008-03-11
Phenotypic Description
R18 mice were identified among G3 generation ENU-mutagenized mice by fundus examination using an indirect opthalmoscope (1). The fundus image of homozygous r18 mice revealed pale and attenuated retinal arteries and mild hypopigmentation. Some r18 mice develop retinal hemorrhage at weaning age, which disappears with increasing age without any treatment (Figure 1).  R18 retinas are hyperpermeable to fluorescein dye, and contain a lower density of retinal small vessels and/or capillaries than heterozygous controls. The retinal vasculature is both reduced and abnormally patterned in r18 mice, and vessels of the outer plexiform layer (OPL) are rarely formed. Transmission electron microscopic analysis of r18 mutant retinas found the presence of immature endothelial cells in lumen-less capillaries, suggesting that the vasculature of r18 retinas fails to fully develop.
 
Homozygotes and heterozygotes are viable and fertile with no gross abnormalities.

 

Nature of Mutation
The r18 mutation was mapped to Chromosome 19, and corresponds to the insertion of a single nucleotide, C, after position 4838 in the low density lipoprotein receptor-related protein 5 encoding gene (Lrp5) transcript. This causes a frameshift after codon 1576, which encodes proline. The frameshift is predicted to replace the C-terminal 39 amino acids of LRP5 with 20 aberrant amino acids, and to cause premature termination at codon 1596 in exon 23 of 23 total exons.
4825  CCCCCCCCCGCCCACCCCCCACAGCCAGTACCTATCTGCAGAGGACAGCTGCCCACCCTCACCAGGCACTGA 4896
1574  -P--P--P--A--H--P--P--Q--P--V--P--I--C--R--G--Q--L--P--T--L--T--R--H--*  1596
         correct                       aberrant residues
The inserted nucleotide is indicated in red lettering.
Protein Prediction
The Lrp5 gene, like its human orthologue mapped to 11q13, encodes a type I single-span transmembrane protein with 1615 amino acid residues in humans and 1614 amino acids in mice.  The human and mouse LRP5 proteins are 95% identical (2).  Vertebrate LRP5 (low-density lipoprotein receptor-related protein 5) is a member of the LDL receptor (LDLR) family, and belongs to a subfamily that consists of the highly homologous LRP6 and the Drosophila homologue Arrow (3).  These proteins function as Wnt (wingless-related MMTV integration site) co-receptors and play critical roles in canonical Wnt/β-catenin signaling (4).
 
The LRP5/6 extracellular domain has three basic domains that define all LDLR family members: the YWTD (tyrosine, tryptophan, threonine, and aspartic acid) β-propeller domain, the EGF (epidermal growth factor)-like domain, and the LDLR type A (LA) domain (2;4;5) (Figure 1).  Each YWTD-type β-propeller domain has six YWTD repeats of 43-50 amino acid residues with the conserved YWTD residues located at the beginning of each repeat, and forms a six-bladed β-propeller structure (6).  LRP5 has four such β-propeller domains that are each followed by an EGF-like domain, which contains approximately 40 amino acids with six conserved cysteine residues, and feature an NGGC (asparagine, glycine, glycine, cysteine) motif. Following the β-propeller/EGF-like repeats are three LA domains, which bind to ligand in the LDL receptor.  It is unknown whether these sites in LRP5/6 interact with Wnt factors, but the β-propeller/EGF-like domains appear to bind extracellular ligands.  The first two sets of β-propeller/EGF-like domains bind Wnts, and two related proteins Wise (Wnt modulator in surface ectoderm), and Sclerostin/SOST (an osteoclast-secreted protein affected in sclerosteosis OMIM #269500(7-12), while the last two sets of β-propeller/EGF-like domains bind Dickkopf (Dkk) ligands (11;13). Dkk, Wise, and SOST are secreted proteins that antagonize Wnt/β-catenin signaling (4;11-13)The LA domains contain conserved cysteine residues, as well as a SDE (serine, aspartic acid, glutamic acid) motif.  There are 13 amino acids separating the LA domains from the transmembrane spanning domain of 23 residues from 1386 to 1408.  The extracellular domain of LRP5 has six potential sites for N-linked glycosylation at residues 93, 138, 446, 499, 705 and 878 (2;5).
 
The LRP5/6 intracellular domain is unique from other LDLR proteins and consists of 207 amino acid residues of which 15-20% are prolines and 15-20% are serines.  Scattered through the intracellular region are five conserved PPP(S/T)P motifs (4).  During Wnt signaling, these domains become phosphorylated and are then able to bind Axin, and recruit it to the plasma membrane (8).  Axin plays a critical role in Wnt/β-catenin signaling (see Background).  The PPP(S/T)P motifs have some similarity with SH3 and EVH1 domains.  SH3 domains are found in many scaffolding/signaling molecules (14), while EVH1 domains are present in a family of signaling proteins involved in actin cytoskeletal regulation (15).  LRP5/6 also contains putative internalization signals (4).
 
The r18 mutation disrupts the C-terminal 39 amino acids of LRP5 including the last three PPP(S/T)P repeats (1).
Expression/Localization
Both LRP5 and LRP6 are widely co-expressed during embryogenesis and in adult tissues.  Human Lrp5 mRNA is detected in most adult and fetal tissues, except testis, bone marrow, peripheral leukocyte and various regions of the brain.  The highest expression levels are found in aorta.  In addition, the tissues of the female reproductive system, including uterus, mammary gland, ovary and placenta all show relatively abundant mRNA levels.  Differential expression levels of Lrp5 mRNA in fetal versus adult tissues are noticeable in spleen, lung and kidney, with higher expression levels seen in fetal tissues (2;5).  
 
During mouse development, Lrp5 is expressed in early embryos beginning prior to gastrulation in visceral endoderm overlying the extra-embryonic ectoderm.  At this stage, Lrp5 is not expressed in mesoderm or definitive endoderm exiting the primitive streak (16).  Later in development and in the adult, immunohistochemistry studies revealed expression in developing osteoblasts (17), macrophages associated with the vitreous microvasculature in the eye, pancreas, spleen, and thymus (9;18), islets of Langerhans, and CNS neurons.  LRP5 expression is also found in two types of vitamin-A metabolizing cell: hepatic stellate cells, and cells of the retinal pigmented epithelium (RPE) (18).  More recently, a Lrp5 reporter gene was reported to be expressed in the endothelial cells of the eye microvasculature (19). In the eye, reporter gene expression is highest in the retinal glia Müller cells (20).
Background
Wnt proteins regulate many stages of development, from patterning of the embryo and generation of tissues and cell types, to regulation of cell movements, polarity, axon guidance and synapse formation (21-23).  Defective Wnt signaling plays major roles in diseases such as cancer and osteoporosis (21;24).  The first step in Wnt signaling is binding of ligand to receptor (Figure 4).  Wnt receptors include members of the Frizzled (Fzd) family of seven-pass transmembrane receptors (22), as well as LRP5/LRP6/Arrow (4), which function as co-receptors for Frizzled proteins.  Multiple studies suggest that Wnt ligands bind to both Frizzled and LRP5/6 receptors and induce a complex formation between Frizzled proteins and LRP5/6 (8;25).  Unlike Frizzled receptors, LRP5/6 specifically functions in canonical Wnt signaling.  Canonical Wnt signaling relies on the regulation of the stability/abundance of the β-catenin protein that acts as a nuclear co-activator for the TCF/LEF (T-cell factor/Lymphoid enhancer factor) family of transcription factors (26;27).  In the absence of Wnt signal, cytosolic β-catenin levels are low due to phosphorylation-dependent ubiquitination and subsequent degradation.  β-catenin phosphorylation involves the sequential actions of casein kinase 1 (CK1) and glycogen synthase kinase 3 (GSK3), and takes place in a protein complex assembled by Axin and APC (28).  Phosphorylated β-catenin is then recognized and ubiquitinated by a ubiquitin-ligase complex. Inhibition of β-catenin phosphorylation can occur through several mechanisms; degradation of the Axin protein, alteration of the Axin complex, or inhibition of CK1 or GSK3 activity (4).  In the absence of β-catenin, TCF/LEF suppresses Wnt-responsive gene expression.  Upon Wnt stimulation, β-catenin phosphorylation and degradation is inhibited, and β-catenin protein is available to associate with TCF/LEF to activate target gene expression. 

Figure 4. Wnt Signaling Pathways. Wnt glycoproteins are palmitolated by porcupine family proteins (Porcn) and secreted into the extracellular matrix with the assistance of the retromer complex. In the extracelluar matrix, heparan sulfate proteoglycans bind to Wnt proteins, stabilizing them for binding to the seven transmembrane Frizzled receptor and coreceptor LRP5 or LRP6. Several Wnt inhibitors, including Dickkopf (Dkk), Wnt-inhibitor protein (WIF), soluble Frizzled-related proteins (SFRP), Cerberus, Frzb, and Wise, bind Wnts or their receptors directly and prevent Wnt from interacting with LRP5/6 and Frizzled. Canonical Wnt/β-catenin pathway: In the absence of Wnt, β-catenin is constantly degraded. β-catenin is phosphorylated by glycogen synthase kinase 3 (GSK3) and casein kinase 1α (CK1α) in a destruction complex that also contains adenomatous polyposis coli (APC) and Axin. Phosphorylation allows association with β-TrCP, an E3 ubiquitin ligase subunit that targets β-catenin for proteasome-mediated degradation. Thus, β-catenin cannot travel to the nucleus and Wnt target genes are repressed by lymphoid enhancer-binding factor 1/T cell-specific transcription factor (LEF/TCF) proteins. Wnt binding to Frizzled and LRP5/6 results in recruitment of Dishevelled (Dsh) and Axin, and LRP5/6 phosphorylation by GSK3 and CK1γ. Dsh is also phosphorylated by casein kinase 1/2 (CK1/2), metastasis associated kinase (MAK), protein kinase C (PKC), and Par1. These events disrupt the β-catenin destruction complex, thereby permitting the stabilization of β-catenin, which accumulates in the cell and translocates into the nucleus where it associates with and coactivates LEF/TCF to stimulate target gene expression. The two non-canonical Wnt signaling pathways control cell polarization and migration and do not require LRP5/6 nor act through β-catenin. In the Planar Cell Polarity Pathway, Wnt-activated signals arising from Frizzled recruit Dsh to the cell membrane. Dsh activates cytoskeletal regulatory pathways, either directly (for Rac) or through Dishevelled associated activator of morphogenesis 1 (Daam1) (for Rho and profilin). In addition to cytoskeletal regulation, Rac also controls transcription through activation of JNK. In the Wnt/Ca2+ Pathway, binding of Wnt to Frizzled recruits G-proteins that activate Dsh. Several molecules subsequently control Ca2+ release from the endoplasmic reticulum, including Protein Kinase G (PKG) that inhibits Ca2+ release, and phospholipase C (PLC) that stimulates Ca2+ release through the generation of IP3. Diacylglycerol (DAG), also generated by PLC, together with Ca2+, activates protein kinase C (PKC), leading to control of tissue separation through Cdc42. Ventral fate is regulated by the Wnt/Ca2+ pathway through the action of calcineurin and nuclear factor of activated T cells (NFAT). The Wnt/Ca2+ pathway also inhibits the canonical Wnt pathway through calcium/calmodulin-dependent protein kinase II (CamKII), TAK1, and NEMO. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

 

The eyes are bilaterally symmetrical organs that originate from a single field positioned in the anterior portion of the neural plate.  Eye formation is a complex process that involves multiple signaling pathways including Wnt signaling.  During embryogenesis, the development and differentiation of the eye requires the concomitant formation of the neural/glial elements along with a dense vascular network.  Blood vessels that supply the inner portion of the retina are extensively reorganized during development.  Initially, the inner part of the eye is metabolically supported by the hyaloid vasculature, an arterial network in the vitreous. In the latter stages of development, the hyaloid vasculature is replaced by the retinal vasculature.  This switch occurs in humans around mid-gestation and in mice around birth (29).  As hyaloid vessels regress, a vascular plexus emerges from the optic nerve head giving rise to the retinal vasculature. This primary vessel plexus remodels into three parallel inter-connected networks, located in the nerve fiber layer and the plexiform layers.  Vessels at the periphery of the retina are less mature than more central vessels during early postnatal development.  The outer plexiform layer (OPL) of the retinal vasculature develops by sprouting from the primary plexus.  Development of the outer plexus is disrupted by mutations in the Wnt receptor Frizzled 4 (FZD4), as well as the Norrie disease gene NDPH.  Norrie disease is characterized by retinal and mental defects, as well as deafness (OMIM #310600) (30).  NDPH and FZD4 are a ligand-receptor pair mediating activation of canonical Wnt signaling (31).  Mutations in these genes are also known to cause FEVR (see below).  In mice, regression of the embryonic hyaloid vessels can be inhibited by ablating macrophages (32).  The interaction between macrophages and blood vessels involves signaling of macrophage-secreted Wnt7b via FZD4 and LRP5 present on endothelial cells (19;31).
 
Genetic studies have linked mutant LRP5 proteins to various human diseases, including osteoporogenic-pseudoglioma syndrome (OPPG, OMIM #259770), familial exudative vitreoretinopathy (FEVR, OMIM #133780), and high bone mass (OMIM #601884).  OPPG is a recessive condition characterized by severe osteoporosis and eye defects due to remnants of embryonic hyaloid vessels in the eye (17;24).  FEVR is a genetically heterogeneous eye disease characterized by incomplete vascularization of the peripheral retina.  FEVR patients also exhibit low bone mass. Mutations of FZD4 and its ligand NDPH cause autosomal-dominant FEVR in some patients (31;33;34), while LRP5 mutations have been found to cause autosomal-dominant or recessive FEVR in humans (4;35;36).  Both OPPG and FEVR mutations in LRP5 are loss-of-function mutations.  Heterozygotes carrying these mutations often display a reduction in bone density (17).  LRP5 gain-of-function mutations in humans, typically clustered in the first β-propeller region of LRP5 (37-39), result in high bone mass.  As mentioned above (Protein Prediction), the Wnt antagonist Sclerostin/SOST binds to this region in LRP5 and is mutated in sclerosteosis, a rare autosomal-recessive bone disorder characterized by skeletal overgrowth and high bone density (OMIM #269500) (12).    
 
Lrp5-/- mice have normal embryogenesis, grow to adulthood and are fertile, but have phenotypes strongly resembling OPPG syndrome in humans (9).  Transgenic mice expressing a missense form of LRP5, known to cause high bone mass in humans, exhibit a similar phenotype (40).  Lrp5-/- animals also have metabolic defects that include impaired glucose tolerance and cholesterol metabolism (41).  Pancreatic islets isolated from Lrp5-/- animals display a reduction in glucose-induced insulin secretion due to decreased levels of intracellular ATP and Ca2+ in response to glucose as well as reduced expression of genes involved in glucose sensing.  Wnts are able to stimulate glucose-induced insulin secretion from normal islets, while Lrp5-deficient islets are unresponsive.  When fed high-fat diets, Lrp5-/- animals have increased levels of plasma cholesterol due to decreased hepatic clearance of remnants of cholesterol-carrying chylomicrons, which are large lipoprotein molecules.  LRP5 binds to apoliprotein E (apoE), a major component of chylomicrons (42).  The role of LRP5 in cholesterol metabolism is similar to classical LDLR function and is probably Wnt independent (43).
 
LRP6 appears to be redundant for LRP5 during development and in many tissues. Lrp6-/- embryos are perinatal lethal and exhibit mid/hindbrain defects, posterior truncation and abnormal limb patterning, which resemble defects of mice mutant for some Wnts (please see gimpy) (44).  Lrp5/6 double mutants die much earlier during gastrulation and lack the primitive streak and nascent mesoderm (16).
Putative Mechanism
Lrp5r18 mutation results in a truncated LRP5 protein that lacks the last three PPP(S/T)P repeats in the C-terminus.  This is likely to be a loss-of-function mutation as Lrp5 knockout mice exhibit similar defects in retinal vasculature (1).  The Wnt/β-catenin pathway is probably impaired in r18 mutants as multiple lines of evidence suggest that the intracellular domain of LRP5, particularly the PPP(S/T)P repeats, is necessary for Axin binding and canonical Wnt signaling (4;7;8;17).  Mutant LRP5 proteins lacking the extracellular domain constitutively bind to Axin and induce LEF-1 activation by destabilizing Axin and stabilizing β-catenin, and LRP5 proteins lacking the last three PPP(S/T)P domains are unable to bind to Axin in vitro (7).  Furthermore, the transfer of a PPP(S/T)P motif to the LDL receptor activates the Wnt pathway in vitro (8).
 
The Wnt/β-catenin pathway is involved in the regression of embryonic hyaloid vessels in the eye.  Mice with a hypomorphic allele of Wnt7b and mice mutant for Fzd4 display persistence of the hyaloid vessels (19;31).  Furthermore, Lrp5 knockout animals also display this phenotype (9).  It is interesting that many of the mutations affecting this process also affect the development of the adult retinal vasculature, particularly the OPL, suggesting that the same signaling pathways are used in both systems (29).  Mutations in NDPH, a non-Wnt ligand that binds to the FZD4 receptor, affect both retinal vasculature and regression of the hyaloid vessels (33;45).  This suggests that signaling through FZD4/LRP5 may be induced by either Wnt7b or NDPH. A role for Wnt7b in development of the adult retinal vasculature has not been demonstrated.  Hyaloid regression occurs through macrophage-induced death of the endothelial cells present in the vessels (19;32). In the retina, LRP5 expression in both endothelial cells of the microvasculature as well as retinal Müller cells suggests that Wnt signaling in either of these two cell types could be responsible for the lack of vasculature present in Lrp5 mutant mice.  Müller cells, in particular, may be important considering the high levels of Lrp5 expression in these cells (20).

Lrp5 mutant animals display a reduction of a Müller cell-specific glutamine transporter, Slc38a5, and showed a decrease in b-wave amplitude of electroretinogram (ERG) (20). The a-wave of an ERG is produced by photoreceptors while a mixture of retinal cells, including Müller cells, contributes to the b-wave.  Interestingly, the angiogenesis factor VEGF (vascular endothelial growth factor) and its receptor are transiently expressed in Müller cells prior to vascularization (46;47), and decreased Slc38a5 is also seen in Ndph knockout mice (48).  NDPH in Müller cells has been shown to activate FZD4 in endothelial cells (49).  Although  LRP5 is a co-receptor for FZD4, the phenotypes of Lrp5 knockout and Fzd4 knockout mice differ as FZD4 deficient animals also display defects in the vessels of the surface ganglion cell layer.  It is possible that LRP6 compensates for LRP5 function in this region.
 
Considering the diverse roles of canonical Wnt signaling in development and disease, it is likely LRP5 has additional roles beyond those described to date.  Wnt signaling has been shown to be important at multiple stages of eye development and is necessary for the specification of the eye field as well as appropriate retinal and lens development.  LRP5 has been shown to be expressed in many tissues in both the embryo and adult, including the RPE of the eye (18).  It is likely LRP6 has functional redundancy with LRP5 during early eye development (16;44), but it is possible that additional non-redundant roles for LRP5 remain to be discovered.
Primers Primers cannot be located by automatic search.
Genotyping
R18 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.
 
Primers for PCR amplification
R18(F): 5’- CCACCACCACAGTATGCCTTTAGG -3’
R18(R): 5’- CCACTGTACAAAGTTTTCCCAGCCC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
R18_seq(F): 5’- TGGAACTCACTTTGTAGACCAGG -3’
R18_seq(R): 5’- CACATTTCTCACTTGTTAAAAATCCC -3’
 
The following sequence of 709 nucleotides (from Genbank genomic region NC_000085 for linear DNA sequence of Lrp5) is amplified:
 
100984    ccaccac cacagtatgc ctttaggaaa tctttctttt tttttttttt tttttttttt
101041 tttttttttg gtttttcgag acagggtttc tctttatagc tcctctggct gtctgtcttg
101101 gaactcactt tgtagaccag gctggcctcg aactcagaaa tccgcctgcc tctgcctccc
101161 gagtgctggg attaaaggcg tgcgccacca cacccggctc aaggagcagc cttgtacaca
101221 ggtggctagg cacacatgtg aacttcttct gtgttccttc taggccctac gtcattcgag
101281 gtatggcacc cccaacaaca ccgtgcagca cagatgtgtg tgacagtgac tacagcacca
101341 gtcgctggaa gagcagcaaa tactacctgg acttgaattc ggactcagac ccctaccccc
101401 cccccgcccac cccccacagc cagtacctat ctgcagagga cagctgccca ccctcaccag
101461 gcactgagag gagttactgc cacctcttcc cgcccccacc gtccccctgc acggactcgt
101521 cctgacctcg gccgtccacc cggccctgct gcctccctgt aaatattttt aaatatgaac
101581 aaaggaaaaa tatattttat gatttaaaaa ataaatataa ttgggatttt taacaagtga
101641 gaaatgtgag cggtgaaggg gtgggcaggg ctgggaaaac tttgtacagt gg
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the inserted C is shown in red text.
References
    17.  Gong, Y., Slee, R. B., Fukai, N., Rawadi, G., Roman-Roman, S., Reginato, A. M., Wang, H., Cundy, T., Glorieux, F. H., Lev, D., Zacharin, M., Oexle, K., Marcelino, J., Suwairi, W., Heeger, S., Sabatakos, G., Apte, S., Adkins, W. N., Allgrove, J., rslan-Kirchner, M., Batch, J. A., Beighton, P., Black, G. C., Boles, R. G., Boon, L. M., Borrone, C., Brunner, H. G., Carle, G. F., Dallapiccola, B., De, P. A., Floege, B., Halfhide, M. L., Hall, B., Hennekam, R. C., Hirose, T., Jans, A., Juppner, H., Kim, C. A., Keppler-Noreuil, K., Kohlschuetter, A., LaCombe, D., Lambert, M., Lemyre, E., Letteboer, T., Peltonen, L., Ramesar, R. S., Romanengo, M., Somer, H., Steichen-Gersdorf, E., Steinmann, B., Sullivan, B., Superti-Furga, A., Swoboda, W., van den Boogaard, M. J., Van, H. W., Vikkula, M., Votruba, M., Zabel, B., Garcia, T., Baron, R., Olsen, B. R., and Warman, M. L. (2001) LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development, Cell 107, 513-523.
    20.  Xia,C.H., Yablonka-Reuveni,Z., and Gong,X. (2010) LRP5 is required for vascular development in deeper layers of the retina. PLoS One 5, e11676.

 

 

 

 

 

    49. Ye,X., Wang,Y., Cahill,H., Yu,M., Badea,T.C., Smallwood,P.M., Peachey,N.S., and Nathans,J. (2009) Norrin, frizzled-4, and Lrp5 signaling in endothelial cells controls a genetic program for retinal vascularization. Cell 139, 285-298.

 

 

Science Writers Nora G. Smart
AuthorsChun-Hong Xia, Xin Du, Xiaohua Gong, Bruce Beutler
List |< first << previous [record 2 of 2]
Edit History
2011-02-25 10:23 AM (current)
2011-02-25 10:03 AM
2011-02-25 9:50 AM
2011-01-13 2:26 PM
2011-01-10 1:45 PM
2011-01-07 9:37 AM
2010-09-30 12:28 PM
2010-05-14 12:07 PM
2010-02-04 9:04 AM