Allele | two-tone | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 58,439,001 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Edar | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | ectodysplasin-A receptor | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 58,436,611-58,511,476 bp (-) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008] PHENOTYPE: Mutations in this gene produce abnormalities of the hair,teeth and some exocrine glands. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Serine changed to Cysteine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000003312] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9R187 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000003312 Gene: ENSMUSG00000003227 AA Change: S344C
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.3015 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.183) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(14) : Chemically induced (ENU)(2) Chemically induced (other)(1) Radiation induced(1) Spontaneous(4) Targeted(4) Transgenic(2) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Live Mice | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:38 PM by Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2018-02-09 2:20 PM by Jamie Russell | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-08-27 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The two-tone phenotype was identified among G3 mice of the pedigree R5847, some of which showed tan specs on the back and collar area (Figure 1). The mice also show hair loss around their ears (Figure 2). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 55 mutations. Both of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 10: Edar and Pbld1. The mutation in Edar was presumed causative because the hair loss and pigmentation phenotypes are similar to that of other Edar mutant alleles (see MGI for a list of Edar alleles). The mutation Edar is an A to T transversion at base pair 58,603,179 (v38) on chromosome 10, or base pair 72,518 in the GenBank genomic region NC_000076.6. Linkage was found with a recessive model of inheritance (P = 3.294 x 10-8), wherein seven affected mice were homozygous for the variant allele, and 39 unaffected mice were either heterozygous (N = 19) or homozygous for the reference allele (N = 17) (Figure 3); genotyping failed for three unaffected mice. The mutation corresponds to residue 1,289 in the mRNA sequence NM_010100 within exon 12 of 12 total exons.
The mutated nucleotide is indicated in red. The mutation results in a serine to cysteine substitution at position 344 (S344C) in the EDAR protein, and is strongly predicted by Polyphen-2 to be damaging (score = 1.000). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
The EDAR protein consists of 448 amino acids, and belongs to the tumor necrosis factor receptor (TNFR) superfamily (1). Mouse EDAR is a type I transmembrane protein (extracellular N terminus), containing a cleavable signal peptide at the N terminus, followed by a 159 amino acid TNFR-like extracellular domain. The extracellular domain, responsible for ligand binding, contains 14 cysteine residues residing in three cysteine-rich domains (CRDs) similar to those of TNFR (1;2). The 237 amino acid intracellular region of EDAR contains a segment near the C-terminus with homology to the death domain of TNFR and other TNFR-like proteins (1;2). The death domain was first identified in proteins involved in cell death induction, but it is now known to function as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. In the case of EDAR, it does not seem to connect to the apoptotic machinery. The two-tone mutation is a serine to cysteine substitution at position 344 (S344C). This residue is located just N terminal to the death domain. For more information about Edar, see the record for achtung2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The four mutant mouse phenotypes Tabby (Tb), downless (dl), Sleek (Sl) and crinkled (cr), first reported in the 1950s, are characterized by lack of hair on the tail and behind the ears, lack of or abnormal morphology of incisors, a reduced number of vibrissae, and occasionally a kinked tail tip [(3-5) and reviewed in (6)]. Further study demonstrated that sweat glands (normally on the footpads), lacrimal, Meibomian and submandibular glands, and three of four types of mouse hair, are lacking in these mutants (6). Human patients also develop a similar syndrome, hypohidrotic (or anhidrotic) ectodermal dysplasia (HED), which may be transmitted in an autosomal dominant (OMIM #129490), autosomal recessive (OMIM #224900), or X-linked recessive (OMIM #305100) manner. Humans with HED typically have missing or sparse hair, missing or misshapen teeth, and absent or reduced ability to sweat. The reduced ability to sweat can cause hyperthermia, and results in a 30% mortality rate in children up to age 2 if the condition is not recognized (7). HED patients also have dry skin, eyes, airways and mucous membranes. Recently, ocular surface abnormalities (corneal lesions, inflammation) likely due to a lack of Meibomian glands were reported in both human HED patients and in Tabby mice (8;9). Mutations in EDA (10), EDAR (2) and EDARADD (11) are now known to cause HED in humans, as well as the Tb (12;13), dl or Sl (1), and cr (11;14) phenotypes, respectively, when the orthologous genes are mutated in mice. Mutations in EDAR account for approximately 25% of cases, and can cause both autosomal dominant or recessive forms of HED (15;16). EDA (ectodysplasin), EDAR and EDARADD (EDAR-associated death domain) form the ligand, receptor and adaptor proteins, respectively, of a TNF-related signaling pathway specific to the development of so-called skin appendages, ectoderm-derived tissues including hair follicles, nails, teeth and exocrine glands in mammals. Signaling from EDAR is mediated by the TRAF6/TAK1/TAB2 complex, and ultimately activates NF-κB to stimulate gene transcription. EDA binds to EDAR as a trimer, leading to the recruitment of its specific adapter, EDARADD, through receptor/adapter death domain interactions (11). EDARADD recruits a complex containing TRAF6, TAB2, and TAK1. The TRAF6/TAK1/TAB2 complex activates the IKK complex to phosphorylate IκB, which then releases NF-κB for translocation to the nucleus and activation of gene expression (11;17-19). The downstream targets of EDAR signaling are reported to include proteins of the Wnt, Sonic hedgehog (Shh), bone morphogenetic protein (BMP) and lymphotoxin- β (LTβ) pathways, which were identified by comparative gene expression analysis of Tabby and wild type skin [reviewed in (20)]. The specific role of these pathways in skin appendage development and the mechanisms by which they interface with EDAR signaling not well understood. The two-tone mutation results in a serine to cysteine substitution at position 344. This residue is located just outside the death domain (aa ~356-431) (1). The two-tone mutation may disrupt folding of the death domain, which could prevent recruitment and subsequent signaling by EDARADD. Several EDAR mutations causing HED in humans or mice disrupt the function of the death domain. For example, the dl mutation is an E to K point mutation of residue 379, within the death domain, and the Sl mutation truncates EDAR just before the death domain (1). It appears that most HED-causing mutations in human EDAR occur within either the death domain or the ligand binding domain (2;15). Two Edar mouse mutants showed aberrant pigmentation, namely darkened and greasy coats (on the C3H3B/FeJ (21) and 101/H* C3H/HeH (MGI) genetic backgrounds). The connection between EDAR signaling and pigmentation was not discussed. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer two-tone_pcr_F: TGCGGTCAAAGAGCTGCATG two-tone_pcr_R: GCAGTGTACTAGCTCTGGACTTAAC Sequencing Primer two-tone_seq_F: AGCTGCATGCCATCAGTCATG two-tone_seq_R: CGTTGACTTTTGAATACCGAACCAG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 505 nucleotides is amplified (chromosome 10, - strand): 1 gcagtgtact agctctggac ttaacatcaa agtcacgttg acttttgaat accgaaccag Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
4. Phillips, R. J. S. (1960) New mutant, Mouse News Lett 23, 29-30.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Jami Keef, Lauren Prince, Jamie Russell, and Bruce Beutler |