Phenotypic Mutation 'minnie' (pdf version)
List |< first << previous [record 13 of 16] next >> last >|
Alleleminnie
Mutation Type splice acceptor site (7 bp from exon)
Chromosome13
Coordinate38,606,734 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Bloc1s5
Gene Name biogenesis of lysosomal organelles complex-1, subunit 5, muted
Synonym(s) 1810074A19Rik, Muted, mu, BLOC-1 subunit
Chromosomal Location 38,592,842-38,635,109 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of BLOC-1 (biogenesis of lysosome-related organelles complex 1). Components of this complex are involved in the biogenesis of organelles such as melanosomes and platelet-dense granules. A mouse model for Hermansky-Pudlak Syndrome is mutated in the murine version of this gene. Alternative splicing results in multiple transcript variants. Read-through transcription exists between this gene and the upstream EEF1E1 (eukaryotic translation elongation factor 1 epsilon 1) gene, as well as with the downstream TXNDC5 (thioredoxin domain containing 5) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mutations at this locus cause pigment dilution, prolonged bleeding time, and inner ear abnormalities, modeling Hermansky-Pudlak Syndrome. [provided by MGI curators]
Accession Number
NCBI RefSeq: NM­_193063; MGI: 2178598
Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000036614 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
coiled coil region 156 184 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
hearing/vestibular/ear
pigmentation
skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(4) : Gene trapped(1) Spontaneous(2) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Bloc1s5 APN 13 38619182 missense probably damaging 1.00
IGL02530:Bloc1s5 APN 13 38603883 missense probably damaging 1.00
R0685:Bloc1s5 UTSW 13 38603919 missense probably benign
R1763:Bloc1s5 UTSW 13 38619084 splice site probably benign
R4852:Bloc1s5 UTSW 13 38634984 missense probably damaging 1.00
R6809:Bloc1s5 UTSW 13 38603985 missense probably benign
R6923:Bloc1s5 UTSW 13 38631064 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
Repository

none

Last Updated 2016-05-13 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 2008-07-15
Phenotypic Description

Minnie was identified as a visible phenotype among N-ethyl-N-nitrosourea (ENU)-induced G3 mutant mice.  Minnie homozygous animals have a light gray coat color and black eyes.  They also display a head tilt.  The minnie mutation does not cause susceptibility to mouse cytomegalovirus (MCMV).

Nature of Mutation
The minnie mutation was mapped to Chromosome 13, and corresponds to a T to A transversion at position 4028 in the genomic DNA sequence of the muted gene (Genbank genomic region NC_000079 for linear genomic DNA sequence of muted).  The mutation is located within intron 1, seven nucleotides upstream from the start of exon 2, and impairs the acceptor splice site of intron 1.  The mutation is predicted to result in skipping of the 83-nucleotide exon 2 (out of 5 total exons), which would delete amino acids 36-63 of the protein, destroy the reading frame, and insert 11 aberrant amino acids before creating a premature stop codon.  The effect of the mutation at the cDNA and protein level has not been tested. 
 
      <--exon 1  <--intron 1 exon 2-->  exon 3-->
165 ATTATCAAGG…………TCTGTTTAGATCTTGGAG………GAAAAACGTGGCCTTCGAGAATTGCGCGTTCTTAA 1592
533  -I--I--K--             D--L--G--   G--K--T--W--P--S--R--I--A--R--S--*  44
      correct                deleted                 aberrant
 
 
The acceptor splice site of intron 13, which is destroyed by the minnie mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.
Protein Prediction
The mouse muted protein has 185 residues, is 76% identical to the human protein, and forms part of the biogenesis of lysosome-related organelle (LRO) complex 1 (BLOC-1; see Figure 1 and Background) (1).  Muted homologues are found only in metazoans, as is the case for several other proteins involved in organogenesis and trafficking of specialized organelles.  Muted has weak homology to only two other mammalian proteins: α-actinin and the human transcriptional regulator basic leucine zipper protein BACH1 (BTB and CNC homology 1) with the similarities occurring over small regions (2). 
 
The muted protein is predicted to form coiled coil structures, which are implicated in protein-protein interactions (1).  There are no other recognizable domains or motifs except that the human muted protein contains a possible vacuolar targeting motif (Thr-Leu-Pro-Lys at amino acids 90-93), consistent with its putative role in lysosomal or early endosomal trafficking (see Background) (2;3).  This motif is absent from the mouse sequence.
 
The minnie mutation may delete exon 2, resulting in a protein with only 35 N-terminal amino acids corresponding to the normal sequence.  It is not known whether this protein is expressed in minnie mice, nor whether it is the only muted product present in mutant animals.  The mutated protein is predicted to be non-functional.
Expression/Localization
The muted transcript is expressed ubiquitously in the mouse, with relatively lower expression in skeletal muscle.  Transfection of a melanosomal cell line with epitope-tagged muted constructs resulted in localization of the transfected protein to vesicles distributed throughout the cell body and dendrites.  The vesicles were not coincident with melanosomes (2).  The vesicular location is consistent with its putative role in vesicle trafficking (see Background).
Background
Hermansky-Pudlak syndrome (HPS; OMIM #203300) is a disorder with an array of clinical symptoms that are caused by alterations at numerous independent loci.  HPS is commonly characterized by oculocutaneous albinism (OCA), prolonged bleeding, and lysosomal hyposecretion.  In addition, subsets of patients exhibit pulmonary fibrosis, immunodeficiency, and inner-ear abnormalities.  Most of these conditions are known to arise from defects in the biogenesis and/or function of lysosome-related organelles (LROs), such as melanosomes and platelet dense granules (4).  These organelles are cell-type specific modifications of the post-Golgi endomembrane system, and may share various characteristics with lysosomes, such as integral membrane proteins and an acidic intralumenal pH (5).  At least eight types of human HPS have been described, and mutations affecting at least 15 loci in mice create HPS-like disease.  The human HPS loci and their mouse equivalents are as follows: HPS1/pale ear (6); HPS2/pearl (7) (mutated in bullet gray); HPS3/cocoa (8) (mutated in pam gray); HPS4/light ear (9); HPS5/ruby-eye 2 (10) (mutated in toffee and dorian gray); HPS6/ruby-eye (10) (mutated in stamper-coat); HPS7/sandy (11) (mutated in salt and pepper); and HPS8/reduced pigmentation (12). 
 
Most of the genes associated with the syndrome encode subunits of protein complexes involved in intracellular trafficking, and are important for the trafficking of lysosomes, lysosomal-related organelles or components of these organelles (Figure 2).  Based on biochemical studies, it has been proposed that HPS proteins assemble into four stable complexes, BLOCs (biogenesis of lysosome-related organelle complex) 1, 2, and 3, and the adaptor protein 3 (AP-3) complex.  Mutation of the β3A subunit of the AP-3 complex causes HPS2 (13-16).  The following components make up the 200-230 kD BLOC-1 complex: pallidin, dysbindin, BLOC subunit 1 (BLOS1), BLOS2, BLOS3, cappuccino, muted, and snapin.  The proteins HPS3, HPS5, and HPS6 comprise BLOC-2 (350 kD).  BLOC-3 (175 kD) is composed of HPS1 and HPS4. 
 
Of the BLOC-1 components, mutations in dysbindin or dystrobrevin binding protein 1 (DTNBP1) cause HPS7 (11), while mutations in BLOS3 causes HPS8.  Mutations in several of the other BLOC-1 subunits, including muted, cause HPS-like disease in mice (4).  The muted mouse has a hypopigmented coat and light eyes at birth due to reduced melanosome number and abnormal morphology, abnormal renal tubule morphology, lysosomal protein accumulation, and platelet storage pool deficiency causing prolonged bleeding.  In addition to these defects, muted animals often have a head tilt caused by loss of one or more otoliths of the inner ear, which are tiny calcium carbonate crystals sensitive to gravity and head motion.  Muted mouse phenotypes are highly similar to those seen in the pallid and mocha mouse mutant models of HPS (2;17).  The pallid gene encodes pallidin, another component of the BLOC-1 complex (1;18), while the mocha gene encodes the δ subunit of the AP-3 complex (19).  An early transposon (Etn) insertion into the third intron of the muted gene has been identified as the mutation underlying the phenotype in muted mice.  This results in an in-frame insertion into the translated protein at position 106, predicting a 246 amino acid protein.  However, a significant reduction in mRNA levels is observed in these animals.  The muJ allele contains a deletion of a single base pair within exon 1 of the mutated gene that results in a truncated protein of 58 amino acids, most of which are aberrant (2).
 
Muted is a confirmed component of the BLOC-1 complex, as shown by coimmunoprecipitation of dysbindin, pallidin and muted from transfected cells (1).  In yeast two-hybrid experiments, muted was found to bind to dysbindin and to BLOS2 (20).  Furthermore, subunits of the BLOC-1 complex are found to be destabilized in protein extracts derived from mice mutated in most BLOC-1 components (1;11;20).  Thus, muted mice exhibit destabilization of pallidin and dysbindin, while muted protein levels are reduced in pallid (encoding pallidin), sandy (encoding dysbindin) and reduced pigmentation (encoding BLOS3) animals (1;11;20).  The function of BLOC-1 is incompletely understood, but the ability of pallidin to bind to syntaxin 13 (18), a SNARE family member involved in vesicle targeting, docking and fusion with target membranes, and snapin to interact with the SNARE complex in neurons (21), suggests it may regulate vesicle docking and fusion.  BLOC-1 has been shown to physically interact with both BLOC-2 and AP-3 complexes to facilitate protein trafficking on endosomes (22).  However, additional evidence suggests that melanosome maturation requires at least two cargo transport pathways to transport melanogenic proteins from the early endosome to the melansome.  One pathway involving tyrosinase (mutated in ghost) transport is mediated by the AP-3 complex, while the other pathway necessary for tyrosinase-related protein-1, Tyrp1, is mediated sequentially by BLOC-1 then BLOC-2 (3).  In addition, the BLOC-1 complex is involved in localization of the copper transporter ATP7A to the melanosome (see records for Tigrou and Tigrou-like).   ATP7A is then able to supply copper to tyrosinase, which is critical for tyrosinase enzymatic activity and subsequent pigment production (23).
 
The BLOC-1 genes BLOS3, MUTED, and DTNBP1 have been associated with schizophrenia, a psychotic disorder with multiple symptoms including hallucinations, inappropriate emotional responses, disordered thinking and erratic behavior (OMIM #181500) (24-26).  Furthermore, transfection of DTNBP1 and MUTED siRNA in neuroblastoma cells resulted in impaired trafficking of the dopamine D2 receptor (DRD2).  DRD2 signaling is implicated in schizophrenia (27).  Another study found no association between the DTNBP1 haplotypes identified in (23) and (24) and schizophrenia in a different patient sample (28).  These conflicting data suggests further research needs to be done on whether mutations of BLOC-1 components can contribute to schizophrenia.  However, the mouse BLOC-1 mutants and HPS7 and HPS8 patients do not display behavioral or neurological phenotypes suggesting that BLOC-1 components do not play major roles in the brain (11;12;17;20).
Putative Mechanism
Although the pigmentation and platelet phenotypes of muted mutant mice is well documented, the precise mechanisms by which muted regulates either melanocyte or platelet functions are still unknown.  It is clear that muted is an important component of the BLOC-1 complex as destabilization of other BLOC-1 subunits occurs in muted mice (1;11;20).  Accumulating evidence suggests that the BLOC-1 complex is involved in protein trafficking and regulation of cargo transport pathways from endosomes to melanosomes (3;22).  This is supported by data showing that pallidin is able to interact with actin filaments (1), as well as the t-SNARE syntaxin 13 (18), and that snapin interacts with SNAP-25 in neurons (21).  The SNARE [SNAP (soluble NSF attachment protein) receptor] complex mediates vesicle targeting and fusion with target membranes [reviewed in (29)].  It is composed of at least three SNARE motif-containing proteins (one v-SNARE from the vesicle and two or three t-SNAREs from the target membrane) which form a four-helix bundle that is thought to bring apposing membranes into close enough proximity for fusion.  SNARE complexes all contain one synaptobrevin-related protein (v-SNARE), one syntaxin-related protein (t-SNARE), a protein related to the N-terminal part of SNAP-25 (t-SNARE), and a protein related to the C-terminal part of SNAP-25 (t-SNARE).  Each of these proteins contributes one α-helix to the four-helix bundle.  In the case of the neuronal synaptic SNARE complex, two of the SNARE motifs are provided by SNAP-25.  The interaction of BLOC-1 complex proteins with SNARE proteins suggests that BLOC-1 may specifically affect membrane trafficking by regulating the targeting and fusion of vesicles.
 
Mutations in some HPS proteins cause immunodeficiency.  For example, in HPS2, mutation of the β3A subunit of the AP-3 complex results in immunodeficiency because of defects in natural killer (NK) cells, cytotoxic T lymphocytes (CTLs) and neutrophils (see bullet gray) (13-16).  However, BLOC-1 complex mutant mice pallid, muted and sandy (mutant for dysbindin) have normal CTL function, as measured by ability to kill targets (28), and patients with HPS7 (mutant for dysbindin), and HPS8 do not display any immunological defects (11;12).  The normal resistance of minnie mice to MCMV is consistent with this data.  In contrast, salt and pepper mice, which have a dysbindin defect allelic to sandy, are susceptible to MCMV and display impaired NK cell cytotoxicity.  A similar NK cell defect has been reported for pallid mice (30).  These data suggest the existence of differences in the secretory machinery between NK and CTL cells.    
 
Due to the head tilt displayed by many minnie homozygotes, it is likely that minnie mice have defective otolith formation.  Several mouse models of HPS, including muted, display missing otoliths and balance defects although this phenotype has incomplete penetrance (1;17).  The mechanisms by which deficiencies in gene products that affect lysosomal-like organelle biosynthesis and function also affect development or maintenance of the otoliths of the ear is unclear.  In pallid and mocha mice this defect can be prevented by feeding their mothers with manganese and/or zinc (32;33), suggesting that one or more enzymes needing these cofactors may play a role in otolith formation.  In pallid mice, manganese has been shown to be important for the synthesis of mucopolysaccharides that make up the gelatinous matrix from which otoliths form (34).  Interestingly, mutation of the Cyba gene in mice also results in balance defects due to otolith deficiency as well as a phagosome defect resulting in chronic granulomatous disease (OMIM #233690), an immunodeficiency disorder caused by the inability of phagocytes to kill ingested microbes.  CGD in humans and mice is caused by mutations in subunits of the NADPH oxidase enzyme complex, and the Cyba gene encodes for p22phox, a subunit of this complex.  The NADPH oxidase enzyme complex is responsible for generating superoxide and its derivatives; hydrogen peroxide and hyperchlorous acid, which then kill microbes ingested by phagocytes.  P22phox is also a subunit of the NADPH oxidase enzyme complex present in the inner ear that is necessary for otolith formation.  It is hypothesized that the NADPH enzyme complex provides the necessary ionic conditions that allow calcium carbonate crystals to form (35).  The cause of the otolith deficiency present in muted animals has not been identified.
Primers Primers cannot be located by automatic search.
Genotyping

Minnie genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  

Primers for PCR amplification
Min(F): 5’- GCCTCAGCAAACATTTACAGATGCC -3’
Min(R): 5’- CACAATGGATGGGTTATGCCTGGAG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Min_seq(F): 5’- TAGACGGCTCTCAAAGGTAGTTC -3’
Min_seq(R): 5’- AGGTTTTAGCCCTCAGGAATCAC -3’
 
The following sequence of 1044 nucleotides (from Genbank genomic region NC_000079 for linear DNA sequence of muted) is amplified:
 
3740                     g cctcagcaaa catttacaga tgccgtgctt atttgtgtga
3781 gtttattttc ctgtgttgtc tatctcagca tgggatggct aaggatgtgt atcctcagct
3841 ctgttagaca ttgttagacg gctctcaaag gtagttctac caacgaacac acactggaag
3901 tggaggagtt tccctcctga tccatggtct ggagtggact ttaacctatc tttgcctgtt
3961 ggggaagagt aaaataggcc agagattgca ccacggagtg tgacttaacc cttgattcta
4021 ctttatctgt ttagatcttg gagagattca ttccaggctg ctggatcaca gaccagttac
4081 ccaaggtgaa atccgttact ttgtaaaaga atttgaagta agtatggaaa cttacttggt
4141 tgaaaagatt gtcccagttg ttaatggcct actacacaca agggtgattc ctgagggcta
4201 aaacctgact ttagtttata tcttacaaat atatgtagta aaaatcataa gaagataaaa
4261 agtacttggt aaacgcaagg ccagacaaca ggagatagcg ggccacattc tggtacctac
4321 tccaaactat ttagtatttg tcagttgcaa actgttttcc cgatgaaatc agatagagtg
4381 ggaaaaaagg acctcttagg gattgctggg tctgagtttt cagttgcatt tgttgtggtg
4441 tttccttggt tggcacatac catcaagctg aaacataaga actgcccttg cctctcccat
4501 tccgttcata cccacaacag tgacccagcc ttctacatgg cgtttccatt gcttccgatt
4561 gctgtgcctg ttcagactca gttttcactc tgcctgccag agtgatccaa cattattgga
4621 ctttttaaga ccctttgcca actccaggat gcagttgaag cattcttctg tggcccgccg
4681 atgctatagc ctcaccacct gccactcctc actttgcatg ggagagtatg tggtcctgat
4741 ttatattatt ctaggtctct ccaggcataa cccatccatt gtg                                                          

 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsCarrie N. Arnold, Bruce Beutler
List |< first << previous [record 13 of 16] next >> last >|
Edit History
2011-04-07 4:02 PM (current)
2011-03-24 4:32 PM
2011-03-23 1:20 PM
2010-10-11 3:01 PM
2010-10-11 3:01 PM
2010-07-21 2:59 PM
2010-01-18 12:00 AM