Phenotypic Mutation 'salt_and_pepper' (pdf version)
Allelesalt_and_pepper
Mutation Type splice donor site (3 bp from exon)
Chromosome13
Coordinate44,941,438 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Dtnbp1
Gene Name dystrobrevin binding protein 1
Synonym(s) Bloc1s8, dysbindin, sdy, 5430437B18Rik
Chromosomal Location 44,922,079-45,002,096 bp (-)
MGI Phenotype Mutations at this locus result in pigmentation anomalies of the coat and eye as well as prolonged bleeding times due to platelet abnormalities.
Accession Number

NCBI RefSeq: NM_025772; MGI: 2137586

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000072170 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 97 111 N/A INTRINSIC
Pfam:Dysbindin 172 321 1.8e-39 PFAM
low complexity region 340 351 N/A INTRINSIC
Phenotypic Category decrease in NK cell response, immune system, MCMV susceptibility, pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(47) : Targeted, other(2) Gene trapped(43) Spontaneous(1) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Dtnbp1 UTSW 13 44923193 missense probably damaging 0.99
R1339:Dtnbp1 UTSW 13 44923220 missense probably damaging 0.96
R1967:Dtnbp1 UTSW 13 44953169 splice donor site probably benign
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
MMRRC Submission 010468-UCD
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 04/10/2008
Phenotypic Description

Mice with the salt and pepper (spp) phenotype were identified due to their diluted coat color (Figure 1). They were further found to exhibit marked susceptibility to murine cytomegalovirus (MCMV) infection (MCMV Susceptibility and Resistance Screen), and impaired natural killer (NK) cell cyotoxicity in vivo as measured by reduced clearance of MHC class 1-deficient cells (In vivo NK cell and CD8+ T cell cytotoxicity screen). Spp is allelic to sandy (sdy) (1).

Figure 2. Salt and pepper mice lack serum type I IFN in response to CpG injection compared with ENU-mutagenized G3 mice. Toffee mice, with a mutation in Hps5, display a similar phenotype. 

Salt and pepper mice also display reduced type I interferon (IFN) responses to CpG DNA challenge in vivo (Figure 2) (2). This screen is designed to identify mutations that specifically affect plasmacytoid dendritic cell (pDC) development and function as pDCs are the primary type I IFN producing cell type in response to Toll-like receptor 9 (TLR9), which senses CpG DNA. 

Nature of Mutation
The spp mutation corresponds to an A to T transversion in the donor splice site of intron 5 (GTAAGT -> GTTAGT) of the Dtnbp1 gene on Chromosome 13 (position ­19359 in the Genbank genomic region NC_000079 for linear genomic DNA sequence of Dtnbp1). The mutation results in skipping of the 133-nucleotide exon 5 (out of 10 total exons), destroying the reading frame in the middle of the encoded protein (aberrant amino acids after position 74), and creating a predicted premature stop codon that would truncate the protein after amino acid 76:
 
     <-- exon 4   <--exon 5 intron 5--> exon 6-->
16053 GCTGGCGAG……GCAAGCCTGGGTAAGTGTG…………CTCATTTAG 31927
72    -A--G--E-……-A--S--L-              -L--I--*  76
       correct    deleted               aberrant
Protein Prediction
Figure 3. A, Predicted domains of dysbindin. Dysbindin contains an interrupted coiled-coil protein interaction domain (CC) at amino acid 88-177. The salt and pepper mutation, located in intron 5, results in skipping of exon 5, a frameshift and premature truncation at amino acid 76 (red “x”). B, Components of the biogenesis of lysosomal-related organelle complex 1 (BLOC-1). BLOC-1 is composed of muted, snapin, cappucino (cno), dysbindin, BLOS1, BLOS2, BLOS3 and two pallidin subunits. Direct physical interactions between the different subunits, as determined by yeast two-hybrid, are shown. All of these subunits, except BLOS3, contain predicted coil-coil regions implicated in protein-protein interactions. Figure is adapted from (34).
The dystrobrevin-binding protein 1 (hereafter dysbindin) contains 352 amino acids, and forms part of the biogenesis of lysosome-related organelle complex 1 (BLOC-1; see Figure 1 and Background). Dysbindin contains only one known protein domain, a coiled-coil protein interaction domain between amino acids 88 and 177 (3). Interestingly, the predicted coiled-coil is interrupted between residues 138 and 146, potentially resulting in two separate coiled-coils (3). Data from yeast two-hybrid experiments support a dystrobrevin binding site in the coiled-coil domain of dysbindin (3;4).
 
At least two alternatively spliced transcripts of Dtnbp1 exist, encoding the full length 352 amino acid protein, and a shorter isoform lacking amino acids 171-222 (3). Both forms interact with β-dystrobrevin in yeast two-hybrid experiments (3). On Western blots, two closely spaced bands react specifically with an antibody against the last 156 amino acids of dysbindin; the lower molecular weight band may correspond to the shorter Dtnbp1 transcript (3).
 
The spp mutation alters the consensus splice donor site of intron 5, likely weakening it and causing skipping of exon 5. The predicted result is a severely truncated dysbindin protein with two aberrant C-terminal amino acids. The drastic shortening of dysbindin may render the protein unstable and lead to degradation, but this has not been confirmed.
Expression/Localization
By Northern blot analysis, Dtnbp1 transcript was found in all tissues examined, including brain, thymus, lung, heart, skeletal muscle, stomach, small intestine, liver, kidney, spleen, testis and skin (3). The highest levels were detected in testes, liver, kidney, brain, heart, and lung. When transfected into COS-7 cells, dysbindin is found both diffusely localized in the cytoplasm as well as in the nucleus (3). In muscle cells, dysbindin is found at the sarcolemma (plasma membrane) (3). Dysbindin expression is widespread in the brain, is confined to neurons, and appears to be particularly evident in axons as well as axon terminals (3;5).
Background
Dysbindin was first identified as a 40 kD α- and β-dystrobrevin-interacting protein in yeast two-hybrid screens, which aimed to understand the role of dystrobrevins in the dystrophin-associated protein complex (DPC) in muscle and brain (3). The DPC [also called the dystrophin-glycoprotein complex (DGC)] is a membrane-spanning oligomeric complex required for normal muscle function, and impaired or absent assembly of the complex at the sarcolemma reduces the stability of the membrane, compromising muscle function and leading to muscle degeneration (6;7). Thus, mutations in dystrophin cause Duchenne muscular dystrophy (OMIM #310200), an X-linked disorder characterized most distinctively by progressive proximal muscular degeneration and pseudohypertrophy of the calves. α-dystrobrevin-deficient mice also develop mild muscular dystrophy (8). In agreement with the yeast two-hybrid results, dysbindin could be co-immunoprecipitated with α- and β-dystrobrevin, as well as with dystrophin, and therefore appeared to be a component of the DPC (3).
 
Dysbindin is also a component of the BLOC-1 complex. Mutations in several BLOC-1 subunits cause Hermansky-Pudlak Syndrome-like disease in mice (9). First described in 1959, HPS (OMIM #203300) is a heterogeneous disorder with an array of clinical symptoms caused by alterations at numerous independent loci. HPS is characterized by oculocutaneous albinism (OCA), prolonged bleeding, and pulmonary fibrosis, conditions that arise from defects in the biogenesis and/or function of so-called lysosome-related organelles, such as melanosomes and platelet dense granules (9). These organelles are cell-type specific modifications of the post-Golgi endomembrane system, and may share various characteristics with lysosomes, such as integral membrane proteins and an acidic intralumenal pH (10). At least eight types of human HPS have been described, and mutations affecting at least 15 loci in mice create HPS-like disease. The human HPS loci and their mouse equivalents are as follows: HPS1/pale ear (11); HPS2/pearl (mutated in bullet gray) (12); HPS3/cocoa (mutated in pam gray) (13); HPS4/light ear (14); HPS5/ruby-eye 2 (mutated in toffee and dorian gray) (15); HPS6/ruby-eye (mutated in stamper-coat) (146); HPS7/sandy (17); and HPS8/putatively reduced pigmentation (17).
 
Figure 4. The HPS proteins form several protein complexes (AP-3, BLOC-1, BLOC-2, and BLOC-3) that are involved in trafficking of proteins to lysosomal-related organelles (LROs) from the TGN and affect the synthesis of these organelles.  Particular HPS complexes may affect only a subset of LROs (see text).  It is thought that BLOC-1 and AP-3 mediate early steps of vesicle trafficking from the early endosome, while BLOC-2 and BLOC-3 are likely involved at later stages.  Studies have shown physical interactions between BLOC-1 and AP-3, and BLOC-1 and BLOC-2. For simplicity, only the major cargo proteins affected by each HPS complex are shown (ATP7A, tyrosinase, Tyrp1, LAMP1).  The presence of ATP7A in maturing melanosomes allows the influx of copper and activates tyrosinase.  BLOC-1 is known to bind to the vesicle fusion protein syntaxin 13, which is localized to the stage I melanosome/coated endosome.  BLOC-2 and AP-3 may interact with clathrin.  Melanosomal maturation is shown separately, along with the stages affected by mutations in each HPS complex.  Mutations in the d subunit of the AP-3 complex affect melanosomal maturation between stages III and IV, but, as mentioned above, the AP-3 complex likely mediates early vesicle trafficking.
Most of the genes associated with HPS encode subunits of protein complexes involved in intracellular trafficking. Based on biochemical studies, it has been proposed that HPS proteins assemble into four stable complexes, BLOCs 1, 2, and 3, and the adaptor protein 3 (AP-3) complex (Figure 2). At present, eight proteins are known to make up the 200-230 kD BLOC-1 complex: pallidin, dysbindin, BLOC subunit 1 (BLOS1), BLOS2, BLOS3, cappuccino, muted (mutated in minnie), and snapin. The function of BLOC-1 is incompletely understood, but the ability of pallidin to bind to syntaxin 13 (18), a SNARE family member involved in vesicle targeting, docking and fusion with target membranes, and snapin to interact with the SNARE complex in neurons (19), suggests it may regulate vesicle docking and fusion.
 
Mutations in dysbindin have been demonstrated to cause the sandy (sdy) phenotype in mice and are reported to be associated with Hermansky-Pudlak Syndrome 7 (HPS7) in humans (OMIM *607145) (16). Dtnbp1sdy mice are spontaneously occurring mutants exhibiting diluted pigmentation of eyes and fur, and prolonged bleeding times (1). Platelet dense granules are drastically reduced in number and platelets have both an impaired ability to take up a fluorescent dye and have a reduced collagen-induced aggregation rate in sandy mice (1). Melanosomes, some of which are morphologically abnormal, are also greatly reduced in cells of the eye and skin of sandy mice. The sandy phenotype is caused by a 38 kb deletion in the Dtnbp1 gene spanning sequence from intron 5 to intron 7, which results in the complete absence of dysbindin protein expression (16). In humans, six non-pathological polymorphisms in DTNBP1 were identified among 22 unrelated HPS patients who did not have mutations in HPS1, HPS3, HPS4, HPS5 or HPS6 (16). One nonsense mutation, C307T resulting in the change Q103X, was also identified in one patient.
 
Dysbindin is a confirmed component of the BLOC-1 complex, as shown by coimmunoprecipitation of dysbindin, pallidin and muted from transfected cells, as well as cofractionation of dysbindin and pallidin in size exclusion chromatography and sedimentation velocity analysis of mouse liver extracts (16;20). However, α- and β-dystrobrevin did not cofractionate with dysbindin or pallidin in this experiment (16). Furthermore, a recent re-examination of the interactions between dysbindin and dystrobrevins found that although they interact specifically in yeast two-hybrid experiments, only small amounts of dystrobrevins are coimmunoprecipitated with dysbindin from mouse muscle or brain tissue, comparable to amounts immunoprecipitated using irrelevant control antibodies (4). Further experiments revealed that the dysbindin binding site for dystrobrevins, which mapped to the coiled-coil domain, overlaps with the binding site for the BLOC-1 subunits pallidin, snapin and muted (4). The association between dysbindin and dystrobrevins may therefore be a non-specific coimmunoprecipitation artifact, a possibility supported by the lack of a muscular phenotype in sandy or pallid mice and the HPS patient with the nonsense DTNBP1 mutation (4;16). Alternatively, associations between dysbindin and either the DPC or BLOC-1 complexes may be mutually exclusive and/or cell type specific.
 
Several SNPs in the human DTNBP1 gene are reportedly associated with schizophrenia, a psychotic disorder with multiple symptoms including hallucinations, inappropriate emotional responses, disordered thinking and erratic behavior (OMIM #181500) (21;22). However, another study found no association between the haplotypes identified in (21) and (22) and schizophrenia in a different patient sample set (23). Still other studies find different haplotypes associated with disease (24). Recently, comparison of all reported putative disease-associated haplotypes with genotype data from the HapMap project suggested that the inconsistent haplotypes reported in the association studies are unlikely due to population differences, since the haplotype patterns and frequencies are similar to and consistent with those of HapMap samples (from individuals with similar descent) (25). Thus, the association of DTNBP1 SNPs with schizophrenia cannot be verified at this time. Neither the HPS patient with the C307T mutation nor sandy mice display behavioral or neurological phenotypes (16), consistent with a lack of association between dysbindin mutations and schizophrenia.
Putative Mechanism
Although the pigmentation and platelet phenotypes of dysbindin mutant mice and humans are well documented, the precise mechanisms by which dysbindin regulates either melanocyte or platelet functions are still unknown. Pallidin has been shown to interact with actin filaments (20) and BLOC-1 interacts with AP-3 to support protein trafficking on endosomes (27). BLOC-1 has recently been demonstrated to function in selective cargo (i.e. tyrosinase-related protein-1, Tyrp1) exit from early endosomes toward melanosomes (28). In addition, the BLOC-1 complex is involved in localization of the copper transporter ATP7A to the melanosome (see records for Tigrou and Tigrou-like).   ATP7A is then able to supply copper to tyrosinase, which is critical for tyrosinase enzymatic activity and subsequent pigment production (29). Mutations of AP-3 complex components affect the trafficking of melanosomes in melanocyte dendrites, preventing the appropriate accumulation of melanosomes at the ends of dendrites (see concrete). These data support a role for BLOC-1 and dysbindin in regulating specific protein trafficking in melanosomes.
 
As mentioned above, pallidin also binds to the t-SNARE syntaxin 13 (19), and snapin interacts with SNAP-25 in neurons (20). The SNARE [SNAP (soluble NSF attachment protein) receptor] complex mediates vesicle targeting and fusion with target membranes [reviewed in (30)]. It is composed of at least three SNARE motif-containing proteins (one v-SNARE from the vesicle and two or three t-SNAREs from the target membrane) which form a four-helix bundle that is thought to bring apposing membranes into close enough proximity for fusion. SNARE complexes all contain one synaptobrevin-related protein (v-SNARE), one syntaxin-related protein (t-SNARE), a protein related to the N-terminal part of SNAP-25 (t-SNARE), and a protein related to the C-terminal part of SNAP-25 (t-SNARE). Each of these proteins contributes one α-helix to the four-helix bundle. In the case of the neuronal synaptic SNARE complex, two of the SNARE motifs are provided by SNAP-25. The interaction of BLOC-1 complex proteins with SNARE proteins suggests that BLOC-1 may specifically affect membrane trafficking by regulating the targeting and fusion of vesicles.
 
Mutations in some HPS proteins cause immunodeficiency, as observed in spp mice. For example, in HPS2, mutation of the β3A subunit of the AP-3 complex results in immunodeficiency because of defects in NK cells, cytotoxic T lymphocytes (CTLs) and neutrophils (see bullet gray) (31-34). Interestingly, BLOC-1 complex mutant mice pallid, muted and sandy have normal CTL function, as measured by ability to kill targets (35). Immunodeficiency in spp mice may therefore be due to a specific defect in NK cell function, which remains to be further investigated. 
 
The defect in type I IFN response to CpG displayed by salt and pepper mice suggest a specific defect in pDCs, which are the primary type I IFN producing cells in vivo during most viral infections (36). As components of the innate immune system, these cells express endosomally-localized TLR7  and TLR9, which enable the detection of internalized viral and bacterial nucleic acids, such as ssRNA (via TLR7) or CpG DNA (via TLR9).  TLR7 and 9 signaling occurs via the adaptor protein myeloid differentiation (MyD) 88 (see pococurante and lackadaisical) resulting in the activation of the NF-κB pathway and production of proinflammatory cytokines such as TNF-α (see panr1), as well as the production of large amounts of type I IFN.  Type I IFNs are pleiotropic anti-viral proteins mediating a wide range of effects. Both TNF-α and type I IFN production by pDCs depends on components of the MyD88 signaling pathway including interleukin receptor associated kinase (IRAK)-1 and IRAK-4 (see otiose), interferon response factor (IRF) 5, TNF receptor–associated factor 6 (TRAF6), inhibitor of kappa-B kinase-α (IKKα), osteopontin, and IRF7 (see the record for inept) [reviewed in (37;38)].  The multispanning ER membrane protein UNC93B (mutated in 3d), which is required for trafficking of TLRs 3, 7, and 9 to the endosomal compartment (39), is also necessary for pDCs to sense nucleic acids. pDCs from TLR9-deficient or TLR7-deficient mice (see records for CpG1 and rsq1) fail to produce type I IFN in response to various viral and bacterial pathogens [reviewed by (40)].  An acidic endosomal environment has been shown to be essential for appropriate TLR7 and TLR9 signaling (41-43).
 
LROs share various characteristics with lysosomes and endolysosomes, such as an acidic intralumenal pH (44), and it is possible that trafficking and biogenesis of the endosomal or similar compartment in pDCs is also dependent on HPS proteins. Indeed, mice with mutations in the β3A subunit of the AP-3 complex, and HPS5 also display a defect in pDC function (2), and analysis of DC generated from pearl homozygous mice with a mutation in Ap3b1 suggests that AP-3 is required for the type I IFN response by trafficking TLR9 to a specialized subcellular compartment  (44).  (45). Interestingly, the pDC-specific phenotypes identified in mice with mutations in HPS genes parallel those found in mice homozygous for a mutation in Slc15a4 (see the record for feeble), which encodes PHT1, a proton-dependent oligopeptide transporter (2). PHT1 contains a typical acidic di-leucine motif required for AP-3 transport. PHT1 may regulate endosomal TLR7 and TLR9 signaling either by transporting a critical component into or out of the endosome, or by maintaining the appropriate pH necessary for TLR activation. Thus,  the HPS proteins, including dysbindin, may be required to transport multiple proteins required for TLR signaling to their appropriate subcellular location.
Primers Primers cannot be located by automatic search.
Genotyping
Salt and pepper genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
Primers
Salt(F): 5’- TGACCTTGGAGTCTTTGGGTTAGATGTCTGATAC -3’
Salt(R): 5’- CAGACATAGGCAAATAGGTAACACACACAAAGC-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:20
4) 68°C             1:00
5) repeat steps (2-4) 35X
6) 68°C             5:00
7) 4°C               ∞
 
The following sequence of 584 nucleotides (from Genbank genomic region NC_000079 for linear DNA sequence of Dtnbp1) is amplified:
 
18985                           tgacct tggagtcttt gggttagatg tctgatacaa
19021 gagcagtttg aggtctgctg tacaaatact gagttccttc ctcttctaag aaaaaccagc
19081 aacacaagtg gcactgtctt cagtgtcact gccatctgta gaccatggag ggttgctaaa
19141 gacaaactgg ccgggcctcg gctcgttgac tgactgtgtg cttgagatgt ggttttcctg
19201 agccccgctg gtctgtgttg cagctggtgg acagcgaggt ggtcatgctg tctgcccact
19261 gggagaagaa gaggaccagc ctgaacgagc tgcaggggca gctgcagcag ctgcccgctc
19321 tcctgcagga cttggagtct ctgatggcaa gcctgggtaa gtgtggcctg tgtgtgagag
19381 cagtttcaaa gccctccaag aattcatcaa ttctcagcta ttgctttgaa aataatagtg
19441 cattcttatt gttatataga aatgtattca tttctaaaat ttaccactaa tgctttctgc
19501 ctacagtaag ctaaggaaat aattttagtt ttgttgcttt gtgtgtgtta cctatttgcc
 
Primer binding sites are underlined; the mutated A is highlighted in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsPhilippe Georgel, Karine Crozat, Sophie Rutschmann, Amanda L. Blasius, Bruce Beutler
Edit History
08/16/2011 4:41 PM (current)
11/12/2010 1:19 PM
11/12/2010 11:55 AM
11/12/2010 11:54 AM
10/06/2010 10:10 AM
10/06/2010 10:10 AM
10/06/2010 10:08 AM
10/06/2010 10:07 AM
07/29/2010 9:33 AM
07/29/2010 9:18 AM
07/21/2010 2:35 PM
01/18/2010 12:00 AM