Phenotypic Mutation 'posey2'

• Allele: posey2
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 10,021,585 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Lig4
• Gene Name: ligase IV, DNA, ATP-dependent
• Synonym(s): DNA ligase IV, tiny, 5830471N16Rik
• Chromosomal Location: 10,020,020-10,027,680 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Null homozygotes die late in gestation with extensive CNS apoptosis, blocked lymphopoeiesis and failure of V(D)J joining. Carrier fibroblasts show elevated chromosome breaks. ~40% of homozygous hypomorphs survive, with retarded growth, reduced PBL and progressive loss of hematopoietic stem cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Alanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000093130] [ENSMUSP00000130807]
• AlphaFold: Q8BTF7
• SMART Domains: Protein: ENSMUSP00000093130; Gene: ENSMUSG00000049717; AA Change: T732A

Domain	Start	End	E-Value	Type
Pfam:DNA_ligase_A_N	14	209	1.3e-43	PFAM
Pfam:DNA_ligase_A_M	248	451	2e-50	PFAM
Pfam:DNA_ligase_A_C	476	588	3.3e-16	PFAM
BRCT	656	733	2.8e-14	SMART
Pfam:DNA_ligase_IV	749	784	7.3e-21	PFAM
BRCT	816	901	1.6e-5	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
  (Using ENSMUST00000095476)
• SMART Domains: Protein: ENSMUSP00000130807; Gene: ENSMUSG00000049717; AA Change: T732A

Domain	Start	End	E-Value	Type
Pfam:DNA_ligase_A_N	15	208	8.8e-39	PFAM
Pfam:DNA_ligase_A_M	248	451	2.3e-52	PFAM
Pfam:DNA_ligase_A_C	476	588	4.8e-18	PFAM
BRCT	656	733	2.9e-14	SMART
Pfam:DNA_ligase_IV	750	783	5.5e-17	PFAM
BRCT	816	901	1.6e-5	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
  (Using ENSMUST00000170033)
• Meta Mutation Damage Score: 0.0650
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:35 PM by Anne Murray
• Record Created: 2018-06-13 12:51 PM by Bruce Beutler
• Record Posted: 2018-12-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_176953; MGI:1335098

Alleles Listed at MGI

All Mutations and Alleles(11) Chemically induced (ENU)(1) Gene trapped(4) Targeted(6)

Phenotypic Description

Figure 1. Posey2 mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Posey2 mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Posey2 mice exhibit increased expression of CD44 expression on CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T CD44 MFI Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The posey2 phenotype was identified among G3 mice of the pedigree R6210, some of which showed reduced frequencies of naïve CD4 T cells in CD4 T cells (Figure 1) with concomitant increased frequencies of effector memory CD4 T cells in CD4 T cells (Figure 2) in the peripheral blood. Expression of CD44 was increased on peripheral blood CD4 T cells (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of reduced naive CD4 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 52 mutations (X-axis) identified in the G1 male of pedigree R6210. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes: Usp17le (chromosome 7) and Lig4 (chromosome 8). The mutation in Lig4 was presumed causative mutations in Lig4 are known to cause immune phenotypes (see the record for posey). The mutation in Lig4 is an A to G transition at base pair 9,971,585 (v38) on chromosome 8, or base pair 6,097 in the GenBank genomic region NC_000074. The strongest association was found with a recessive model of inheritance to the frequency of naïve CD4 T cells in CD4 T cells wherein one variant homozygote departed phenotypically from three homozygous reference mice and 17 heterozygous mice with a P value of 9.954 x 10^-7 (Figure 4).  

The mutation corresponds to residue 2,516 in the mRNA sequence NM_176953 within exon 2 of 2 total exons.

2501 TTAGAGTGTTTTAAGACAAAAACATGCGTGCCG 727  -L--E--C--F--K--T--K--T--C--V--P-

The mutated nucleotide is indicated in red. The mutation results in a threonine to alanine substitution at amino acid 732 (T732A) in the LIG4 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.000).

Protein Prediction

Figure 5. Domain structure of LIG4. The posey mutation results in an aspartic acid to glycine substitution at amino acid 275. Other mutations found in LIG4 are noted. Click on each mutation for more information.

Lig4 encodes DNA ligase IV, a member of the ATP-dependent DNA ligase family. DNA ligase IV has a DNA-binding domain (DBD), a catalytic domain that includes nucleotidyltransferase (NTase) and oligonucleotide binding-fold (OBD) domains, a nuclear localization sequence (NLS), two BRCT domains (BRCT I and BRCT II), and an XRCC4-interacting region (XIR) (1;2). NTase and OBD domains are found in DNA and RNA ligases as well as RNA-capping enzymes (3). The NTase domain engages the nicked DNA strand, and the OBD inserts into the minor groove of the DNA duplex opposite the nick, securing the DNA within the active site of the NTase domain (4). The BRCT domains mediate protein-protein interactions. The BRCT I α2 helix is required for adenovirus-mediated degradation of DNA ligase IV (5). The C-terminal region encompassing the two BRCT domains and the XIR is required for the regulation of the nuclear localization and stability of the DNA ligase IV co-factor XRCC4 as well as binding of the XRCC4/DNA ligase IV complex to chromatin (6-8).

The posey2 mutation results in a threonine to alanine substitution at amino acid 732 (T732A); amino acid 732 is within the first BRCT domain.

Please see the record posey for more information about Lig4.

Putative Mechanism

DNA ligase IV is responsible for the ligation step in nonhomologous DNA end joining (NHEJ) and in V(D)J recombination (9;10).

Mutations in human LIG4 are linked to LIG4 syndrome [alternatively, DNA ligase IV deficiency; OMIM: #606593; (11;12)] and resistance to multiple myeloma [OMIM: #254500; (13)]. Patients with LIG4 syndrome exhibit immunodeficiency as well as delays in development and growth (11). Patients also often display unusual facial features, microcephaly, growth and/or developmental delay, pancytopenia, and various skin abnormalities. 

Lig4-deficient mice are embryonic lethal, and the mice exhibited neuronal apoptosis, arrested lymphogenesis, reduced body size, and various cellular defects (14-18). The embryonic lethality, neuronal apoptosis, and fibroblast proliferation/senescence defects observed in the Lig4-deficient mice could be rescued with p53 deficiency; lymphocyte development defects were not rescued (19). K.M. Frank and colleagues propose that most of the phenotypes observed in the Lig4-deficient mice are due to a p53-dependent response to unrepaired DNA damage. The embryonic lethality in the Lig4-deficient mice could also be rescued by deletion of Ku86 (20). Z.E. Karanjawala and colleagues propose that in the case of Lig4 deficiency alone that the lethality phenotype is due the presence of the Artemis:DNA-PK_CS  nuclease. The loss of Ku86 results in a less severe phenotype, because Ku86 is less efficient than Artemis:DNA-PK_CS.  

The Arg278His mutation in humans is linked to Lig4 syndrome. Homozygous Lig4^R278H/R278H knock-in mice exhibited a reduced life span, reduced body weights compared to wild-type controls, reduced fertility, reduced numbers of B220+ cells in the bone marrow, reduced B220+ IgM+ B cells in the spleen, reduced numbers of CD4-CD8- double negative T cells, CD4+CD8+ double positive T cells, B cells, CD4+ T cells, and CD8+ T cells (21). The Lig4^R278H/R278H mice also had reduced IgA, IgG, and IgM in the serum.

Homozygous Lig4 mutant mice (Tyr288Cys) was viable, but showed high levels of endogenous DSBs, immunodeficiency, growth retardation, and reduced brain sizes compared to wild-type mice as well as increased apoptosis in the forebrain, intermediate zone/cortical plate, and ventricular/subventricular zones (22;23). The mice showed impaired V(D)J recombination, B cell class switch recombination, and peripheral lymphocyte survival and proliferation (23). The Tyr288Cys mutant mice also showed a high incidence of thymic tumors.

Homozygous mice (Lig4^tiny/tiny) with an ENU-induced mutation exhibited prenatal lethality (born at 40% of the expected frequency), reduced body sizes, reduced B cell numbers, and lack of CD8+ T cells (MGI:3714853 and (24)). Mouse embryonic fibroblasts from the Lig4^tiny/tiny mice exhibited reduced ability to repair DNA damage from gamma radiation.

The immune phenotypes observed in the posey2 mice indicate loss of DNA ligase IV^posey2 function.

Primers

PCR Primer
posey2_pcr_F: GTGGTCCCAGGAATAACGAC
posey2_pcr_R: TGGTTATCCAAAGGCTGACC

Sequencing Primer
posey2_seq_F: AATCACAGGGGCCATTTCTTCAG
posey2_seq_R: TGGTTATCCAAAGGCTGACCTAGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 409 nucleotides is amplified (chromosome 8, - strand):

1   tggttatcca aaggctgacc tagagaacag aattgcagaa ttcggtggtt atatagtaca
61  gaatccaggc ccggatacat actgtgttat tgcaggttct gagaacgtta gagtgaaaaa
121 cattatttct tcagataaaa atgatgttgt caagcccgag tggcttttag agtgttttaa
181 gacaaaaaca tgcgtgccgt ggcaacctcg ctttatgatt cacatgtgcc cgtcgacaaa
241 gcagcatttt gcccgtgagt atgactgcta tggtgatagc tattttgttg acacagattt
301 ggatcaattg aaagaagtgt ttctaggaat taaacccagt gagcagcaga ctcctgaaga
361 aatggcccct gtgattgctg acttagaatg tcgttattcc tgggaccac

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Tomkinson, A. E., Vijayakumar, S., Pascal, J. M., and Ellenberger, T. (2006) DNA Ligases: Structure, Reaction Mechanism, and Function. Chem Rev. 106, 687-699.

  2. Grawunder, U., Zimmer, D., and Lieber, M. R. (1998) DNA Ligase IV Binds to XRCC4 Via a Motif Located between rather than within its BRCT Domains. Curr Biol. 8, 873-876.

  3. Shuman, S., and Schwer, B. (1995) RNA Capping Enzyme and DNA Ligase: A Superfamily of Covalent Nucleotidyl Transferases. Mol Microbiol. 17, 405-410.

  4. Cotner-Gohara, E., Kim, I. K., Hammel, M., Tainer, J. A., Tomkinson, A. E., and Ellenberger, T. (2010) Human DNA Ligase III Recognizes DNA Ends by Dynamic Switching between Two DNA-Bound States. Biochemistry. 49, 6165-6176.

  5. Gilson, T., Greer, A. E., Vindigni, A., Ketner, G., and Hanakahi, L. A. (2012) The alpha2 Helix in the DNA Ligase IV BRCT-1 Domain is Required for Targeted Degradation of Ligase IV during Adenovirus Infection. Virology. 428, 128-135.

  6. Liu, S., Liu, X., Kamdar, R. P., Wanotayan, R., Sharma, M. K., Adachi, N., and Matsumoto, Y. (2013) C-Terminal Region of DNA Ligase IV Drives XRCC4/DNA Ligase IV Complex to Chromatin. Biochem Biophys Res Commun. 439, 173-178.

  7. Francis, D. B., Kozlov, M., Chavez, J., Chu, J., Malu, S., Hanna, M., and Cortes, P. (2014) DNA Ligase IV Regulates XRCC4 Nuclear Localization. DNA Repair (Amst). 21, 36-42.

  8. Wu, P. Y., Frit, P., Meesala, S., Dauvillier, S., Modesti, M., Andres, S. N., Huang, Y., Sekiguchi, J., Calsou, P., Salles, B., and Junop, M. S. (2009) Structural and Functional Interaction between the Human DNA Repair Proteins DNA Ligase IV and XRCC4. Mol Cell Biol. 29, 3163-3172.

  9. Grawunder, U., Zimmer, D., Fugmann, S., Schwarz, K., and Lieber, M. R. (1998) DNA Ligase IV is Essential for V(D)J Recombination and DNA Double-Strand Break Repair in Human Precursor Lymphocytes. Mol Cell. 2, 477-484.

  10. Meek, K., Gupta, S., Ramsden, D. A., and Lees-Miller, S. P. (2004) The DNA-Dependent Protein Kinase: The Director at the End. Immunol Rev. 200, 132-141.

  11. O'Driscoll, M., Cerosaletti, K. M., Girard, P. M., Dai, Y., Stumm, M., Kysela, B., Hirsch, B., Gennery, A., Palmer, S. E., Seidel, J., Gatti, R. A., Varon, R., Oettinger, M. A., Neitzel, H., Jeggo, P. A., and Concannon, P. (2001) DNA Ligase IV Mutations Identified in Patients Exhibiting Developmental Delay and Immunodeficiency. Mol Cell. 8, 1175-1185.

  12. van der Burg, M., van Veelen, L. R., Verkaik, N. S., Wiegant, W. W., Hartwig, N. G., Barendregt, B. H., Brugmans, L., Raams, A., Jaspers, N. G., Zdzienicka, M. Z., van Dongen, J. J., and van Gent, D. C. (2006) A New Type of Radiosensitive T-B-NK+ Severe Combined Immunodeficiency Caused by a LIG4 Mutation. J Clin Invest. 116, 137-145.

  13. Roddam, P. L., Rollinson, S., O'Driscoll, M., Jeggo, P. A., Jack, A., and Morgan, G. J. (2002) Genetic Variants of NHEJ DNA Ligase IV can Affect the Risk of Developing Multiple Myeloma, a Tumour Characterised by Aberrant Class Switch Recombination. J Med Genet. 39, 900-905.

  14. Frank, K. M., Sekiguchi, J. M., Seidl, K. J., Swat, W., Rathbun, G. A., Cheng, H. L., Davidson, L., Kangaloo, L., and Alt, F. W. (1998) Late Embryonic Lethality and Impaired V(D)J Recombination in Mice Lacking DNA Ligase IV. Nature. 396, 173-177.

  15. Gu, Y., Sekiguchi, J., Gao, Y., Dikkes, P., Frank, K., Ferguson, D., Hasty, P., Chun, J., and Alt, F. W. (2000) Defective Embryonic Neurogenesis in Ku-Deficient but Not DNA-Dependent Protein Kinase Catalytic Subunit-Deficient Mice. Proc Natl Acad Sci U S A. 97, 2668-2673.

  16. Barnes, D. E., Stamp, G., Rosewell, I., Denzel, A., and Lindahl, T. (1998) Targeted Disruption of the Gene Encoding DNA Ligase IV Leads to Lethality in Embryonic Mice. Curr Biol. 8, 1395-1398.

  17. Lee, Y., Barnes, D. E., Lindahl, T., and McKinnon, P. J. (2000) Defective Neurogenesis Resulting from DNA Ligase IV Deficiency Requires Atm. Genes Dev. 14, 2576-2580.

  18. Orii, K. E., Lee, Y., Kondo, N., and McKinnon, P. J. (2006) Selective Utilization of Nonhomologous End-Joining and Homologous Recombination DNA Repair Pathways during Nervous System Development. Proc Natl Acad Sci U S A. 103, 10017-10022.

  19. Frank, K. M., Sharpless, N. E., Gao, Y., Sekiguchi, J. M., Ferguson, D. O., Zhu, C., Manis, J. P., Horner, J., DePinho, R. A., and Alt, F. W. (2000) DNA Ligase IV Deficiency in Mice Leads to Defective Neurogenesis and Embryonic Lethality Via the p53 Pathway. Mol Cell. 5, 993-1002.

  20. Karanjawala, Z. E., Adachi, N., Irvine, R. A., Oh, E. K., Shibata, D., Schwarz, K., Hsieh, C. L., and Lieber, M. R. (2002) The Embryonic Lethality in DNA Ligase IV-Deficient Mice is Rescued by Deletion of Ku: Implications for Unifying the Heterogeneous Phenotypes of NHEJ Mutants. DNA Repair (Amst). 1, 1017-1026.

  21. Rucci, F., Notarangelo, L. D., Fazeli, A., Patrizi, L., Hickernell, T., Paganini, T., Coakley, K. M., Detre, C., Keszei, M., Walter, J. E., Feldman, L., Cheng, H. L., Poliani, P. L., Wang, J. H., Balter, B. B., Recher, M., Andersson, E. M., Zha, S., Giliani, S., Terhorst, C., Alt, F. W., and Yan, C. T. (2010) Homozygous DNA Ligase IV R278H Mutation in Mice Leads to Leaky SCID and Represents a Model for Human LIG4 Syndrome. Proc Natl Acad Sci U S A. 107, 3024-3029.

  22. Gatz, S. A., Ju, L., Gruber, R., Hoffmann, E., Carr, A. M., Wang, Z. Q., Liu, C., and Jeggo, P. A. (2011) Requirement for DNA Ligase IV during Embryonic Neuronal Development. J Neurosci. 31, 10088-10100.

  23. Nijnik, A., Dawson, S., Crockford, T. L., Woodbine, L., Visetnoi, S., Bennett, S., Jones, M., Turner, G. D., Jeggo, P. A., Goodnow, C. C., and Cornall, R. J. (2009) Impaired Lymphocyte Development and Antibody Class Switching and Increased Malignancy in a Murine Model of DNA Ligase IV Syndrome. J Clin Invest. 119, 1696-1705.

  24. Nijnik, A., Woodbine, L., Marchetti, C., Dawson, S., Lambe, T., Liu, C., Rodrigues, N. P., Crockford, T. L., Cabuy, E., Vindigni, A., Enver, T., Bell, J. I., Slijepcevic, P., Goodnow, C. C., Jeggo, P. A., and Cornall, R. J. (2007) DNA Repair is Limiting for Haematopoietic Stem Cells during Ageing. Nature. 447, 686-690.