Phenotypic Mutation 'waffle' (pdf version)
List |< first << previous [record 550 of 584] next >> last >|
Allelewaffle
Mutation Type missense
Chromosome7
Coordinate87,493,221 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Tyr
Gene Name tyrosinase
Synonym(s) Oca1, skc35
Chromosomal Location 87,424,771-87,493,512 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011661; Ensembl: ENSMUST00000004770; MGI: 98880

Mapped Yes 
Amino Acid Change Serine changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000004770] [ENSMUSP00000146757]
SMART Domains Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: S44G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
Pfam:Tyrosinase 170 403 4.8e-45 PFAM
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
(Using ENSMUST00000004770)
Predicted Effect unknown
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation 1352884 24879364
skin/coat/nails 1352884 24879364
Penetrance  
Alleles Listed at MGI

All alleles(121) : Targeted(2) Spontaneous(29) Chemically induced(16) Radiation induced(78)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Tyr APN 7 87437948 missense probably damaging 1.00
IGL01594:Tyr APN 7 87483814 unclassified probably benign
IGL02963:Tyr APN 7 87483997 missense probably benign
IGL03356:Tyr APN 7 87492714 missense possibly damaging 0.71
ghost UTSW 7 87472495 missense probably damaging 1.00
pale_rider UTSW 7 87438023 missense probably damaging 1.00
rufus UTSW 7 87492706 missense probably damaging 1.00
siamese UTSW 7 87438044 missense probably damaging 1.00
Venusaur UTSW 7 87492706 missense
R0322:Tyr UTSW 7 87492917 missense probably benign 0.35
R0479:Tyr UTSW 7 87493221 missense possibly damaging 0.94
R1544:Tyr UTSW 7 87492706 missense probably damaging 1.00
R1546:Tyr UTSW 7 87437992 missense probably benign 0.02
R1606:Tyr UTSW 7 87437971 missense probably benign 0.01
R1666:Tyr UTSW 7 87492941 missense probably damaging 1.00
R2064:Tyr UTSW 7 87492843 missense probably benign 0.13
R2213:Tyr UTSW 7 87492878 missense probably damaging 1.00
R2420:Tyr UTSW 7 87429189 missense probably benign 0.17
R4013:Tyr UTSW 7 87437940 missense probably benign 0.00
R4014:Tyr UTSW 7 87437940 missense probably benign 0.00
R4015:Tyr UTSW 7 87437940 missense probably benign 0.00
R4016:Tyr UTSW 7 87437940 missense probably benign 0.00
R4202:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4205:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4206:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4361:Tyr UTSW 7 87429076 missense probably benign 0.01
R4738:Tyr UTSW 7 87492647 missense probably null 1.00
R5306:Tyr UTSW 7 87438014 missense probably damaging 1.00
R5378:Tyr UTSW 7 87472495 missense probably damaging 1.00
R5395:Tyr UTSW 7 87472490 missense probably damaging 0.98
R5782:Tyr UTSW 7 87493016 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 036996-MU
Last Updated 2016-07-13 2:46 PM by Anne Murray
Record Created 2013-05-08 2:48 PM by Jennifer Weatherly
Record Posted 2016-07-13
Phenotypic Description
Figure 1. The waffle homozygotes have a light tan or yellow coat color.

The waffle mutation was induced by N-ethyl-N-nitrosourea (ENU) mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals. Homozygous waffle mice exhibit a light tan/yellow coat color and black eyes (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 99 mutations. Three affected G3 mice from the waffle pedigree were genotyped at 99 mutation sites and all three mice were homozygous for a mutation in Tyr on chromosome 7. Subsequent analysis of an additional waffle mouse (homozygous for the Tyr mutation) and six unaffected mice (all heterozygous or wild-type for the Tyr locus) supported the Tyr mutation as causative for the waffle phenotype (LOD=5.107). 

 

The waffle mutation is an A to G transition at base pair 87493221 (v38) on chromosome 7, or base pair 191 in the GenBank genomic region NC_000073 encoding Tyr. The mutation corresponds to residue 191 in the NM_011661.4 mRNA sequence in exon 1 of 5 total exons.

 

176 TGGATGGGTGATGGGAGTCCCTGCGGCCAGCTT

39  -W--M--G--D--G--S--P--C--G--Q--L-

 

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to glycine (G) substitution at residue 44 in the Tyr protein.

Protein Prediction
Figure 2. Domain structure of tyrosinase. The waffle mutation causes a serine to glycine substitution at residue 44 of tyrosinase. SP, signal peptide; EGF-like, epidermal growth factor-like laminin domain; TM, transmembrane; CT, cytoplasmic tail. Glycosylation and copper binding sites are indicated in light and dark pink, respectively. Click on the image to view other mutations found in TYR. Click on each mututation for more specific information.

The residue altered by the waffle mutation (Ser44) occurs N-terminal to the epidermal growth factor (EGF)-like laminin domain in the Tyr protein; Ser44 has no known function (Figure 2).

 

Please see the record ghost for information about Tyr.

Putative Mechanism

The waffle mutation causes a weak form of albinism, similar to the spontaneous Tyrc-e allele (extreme dilution; MGI:1855978). Homozygous Tyrc-e mice have pigmented eyes with an off-white/yellow coat that darkens to a brownish shade with age (1). Because waffle mice are not completely white, it is likely that the mutation is hypomorphic and Tyrwaffle retains residual activity sufficient for some pheomelanin but not eumelanin production to occur (2).

 

During melanosome biogenesis and maturation, transport vesicles traffic melanosomal proteins (e.g., Tyr, Tyrp1 (Tyr-related protein 1; see the record for chi), lysosome-associated membrane protein (Lamp), and gp100 (Pmel17) from the trans-Golgi network (TGN) to the melanosomal compartment (3). Regulation of trafficking may be distinct for eumelanosomes, to which Tyr, Tyrp1, and DCT (dopachrome tautomerase) are transported from the TGN, versus pheomelanosomes, to which only Tyr is transported from stage I melanosomes to stage II melanosomes.  Thus, an alternative mechanism for the waffle mutation may be to impair the ability of the mutant Tyr to traffic to eumelanosomes but not pheomelanosomes.

 

The waffle mouse may be a model for oculocutaneous albinism (OCA1) as a Ser44Gly mutation has been identified in a human patient with OCA1 (4). OCA1 can be subdivided into two phenotypes: OCA1A (OMIM: #203100) and OCA1B (OMIM: #606952). Type 1A is characterized by a complete lack of Tyr activity and melanin synthesis resulting in white hair, skin, and blue eyes. Type IB is characterized by reduced Tyr activity; patients have yellow or blond hair (with age). Since waffle mice appear to retain some pigmentation, they may represent a model of OCA1B.  The subtype of OCA1 that the Ser44Gly patient presented with was not discussed.

Primers PCR Primer
waffle(F):5'- TGTGGGGATGACATAGACTGAGCTG -3'
waffle(R):5'- TCACTCCAGGGGTTGCTGGAAAAG -3'

Sequencing Primer
waffle_seq(F):5'- TTACAGTTTCCGCAGTTGAAACC -3'
waffle_seq(R):5'- GAAGTCTGTGACACTCATTAACC -3'
Genotyping
DNA trace (Chr. + strand) showing the waffle mutation.

Waffle genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

 

PCR Primers

Waffle(F): 5’- TGTGGGGATGACATAGACTGAGCTG -3’

Waffle(R): 5’- TCACTCCAGGGGTTGCTGGAAAAG-3’

 


Sequencing Primer

Waffle_seq(F): 5’- TTACAGTTTCCGCAGTTGAAACC-3’


 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 540 nucleotides is amplified (Chr. 7: 87492892-87493431, GRCm38):

 

tgtggggatg acatagactg agctgatagt atgttttgct aaagtgaggt aagaaaagaa

cttattcttt tcggagacac tcaaatcaaa aatgtttctt ctaatcaaga ctcgcttctc

tgtacaattt gggcccccaa atccaaactt acagtttccg cagttgaaac ccatgaagtt

gcctgagcac tggcaggtcc tattataaaa cacagagggc caggactcac ggtcatccac

ccctttgaag gggaactgag gtccagatgg tgcactggac agaaggatat cctggcagga

acctctgcct gaaagctggc cgcagggact cccatcaccc atccatggtg ggcagcattc

ttttgccaac aagttcttag aggaggcaca ggctcgagga aaatggccat cagagatctg

gaaactccac agaaggcaat acaaaacagc caagaacatt ttctccttta gatcatacaa

aatctgcacc aataggttaa tgagtgtcac agacttcttt tccagcaacc cctggagtga

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>C, Chr. + strand; A>G, sense strand).

References
  1. Detlefsen, J. A. (1921) A New Mutation in the House Mouse. Amer Nat. 55, 469-473.
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsJennifer Weatherly Tiana Purrington
List |< first << previous [record 550 of 584] next >> last >|