Incidental Mutation 'R4015:Tyr'
ID311906
Institutional Source Beutler Lab
Gene Symbol Tyr
Ensembl Gene ENSMUSG00000004651
Gene Nametyrosinase
SynonymsOca1, skc35
MMRRC Submission 040952-MU
Accession Numbers

Ncbi RefSeq: NM_011661.4; MGI:98880

Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R4015 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location87424771-87493512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87437940 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 455 (S455P)
Ref Sequence ENSEMBL: ENSMUSP00000004770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004770]
Predicted Effect probably benign
Transcript: ENSMUST00000004770
AA Change: S455P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: S455P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
Pfam:Tyrosinase 170 403 4.8e-45 PFAM
transmembrane domain 474 496 N/A INTRINSIC
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
Allele List at MGI

All alleles(120) : Targeted(2) Spontaneous(28) Chemically induced(16) Radiation induced(78

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Ccdc66 A G 14: 27,483,836 I898T probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Cfap161 C T 7: 83,780,271 G180S probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Mocs2 T C 13: 114,820,798 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Pcdh17 T C 14: 84,447,107 V338A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbm12b1 T C 4: 12,145,491 S488P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Sult6b2 T A 6: 142,790,262 N202I possibly damaging Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp867 A G 11: 59,463,694 F270L probably damaging Het
Other mutations in Tyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Tyr APN 7 87437948 missense probably damaging 1.00
IGL01594:Tyr APN 7 87483814 splice site probably benign
IGL02963:Tyr APN 7 87483997 missense probably benign
IGL03356:Tyr APN 7 87492714 missense possibly damaging 0.71
ghost UTSW 7 87472495 missense probably damaging 1.00
pale_rider UTSW 7 87438023 missense probably damaging 1.00
rufus UTSW 7 87492706 missense probably damaging 1.00
siamese UTSW 7 87438044 missense probably damaging 0.99
Venusaur UTSW 7 87492706 missense probably damaging 1.00
waffle UTSW 7 87493221 missense possibly damaging 0.94
R0322:Tyr UTSW 7 87492917 missense probably benign 0.35
R0479:Tyr UTSW 7 87493221 missense possibly damaging 0.94
R1544:Tyr UTSW 7 87492706 missense probably damaging 1.00
R1546:Tyr UTSW 7 87437992 missense probably benign 0.02
R1606:Tyr UTSW 7 87437971 missense probably benign 0.01
R1666:Tyr UTSW 7 87492941 missense probably damaging 1.00
R2064:Tyr UTSW 7 87492843 missense probably benign 0.13
R2213:Tyr UTSW 7 87492878 missense probably damaging 1.00
R2420:Tyr UTSW 7 87429189 missense probably benign 0.17
R4013:Tyr UTSW 7 87437940 missense probably benign 0.00
R4014:Tyr UTSW 7 87437940 missense probably benign 0.00
R4016:Tyr UTSW 7 87437940 missense probably benign 0.00
R4202:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4205:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4206:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4361:Tyr UTSW 7 87429076 missense probably benign 0.01
R4738:Tyr UTSW 7 87492647 missense probably null 1.00
R5306:Tyr UTSW 7 87438014 missense probably damaging 1.00
R5378:Tyr UTSW 7 87472495 missense probably damaging 1.00
R5395:Tyr UTSW 7 87472490 missense probably damaging 0.98
R5782:Tyr UTSW 7 87493016 missense probably damaging 1.00
R7007:Tyr UTSW 7 87493340 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGTTCAAAAGCTTCCCAATCC -3'
(R):5'- TTTGAACAATGGCTGCGAAGG -3'

Sequencing Primer
(F):5'- TCAAAAGCTTCCCAATCCTATATTC -3'
(R):5'- GCACCGCCCTCTTTTGGAAG -3'
Posted On2015-04-29