Incidental Mutations

41 incidental mutations are currently displayed, and affect 41 genes.
9 are Possibly Damaging.
13 are Probably Damaging.
13 are Probably Benign.
5 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 41 of 41] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 556082 UTSW Aldh18a1 1.000 PIT4498001 G1 225.01 N 19 40574356 N191S T C missense Het probably benign 0.000 phenotype 06/07/2019
2 556045 UTSW Cacnb2 1.000 PIT4498001 G1 225.01 N 2 14874819 L84* T A nonsense Het probably null phenotype 06/07/2019
3 556073 UTSW Cdhr2 0.076 PIT4498001 G1 197.01 N 13 54718239 T284M C T missense Het possibly damaging 0.754 phenotype 06/07/2019
4 556066 UTSW D430042O09Rik 0.000 PIT4498001 G1 194.01 N 7 125813596 T371A A G missense Het probably benign 0.000 phenotype 06/07/2019
5 556051 UTSW Defb45 0.058 PIT4498001 G1 192.01 N 2 152596474 T C start gained Het probably benign 06/07/2019
6 556065 UTSW Dkk3 0.000 PIT4498001 G1 106.01 N 7 112119472 V236M C T missense Het probably benign 0.304 phenotype 06/07/2019
7 556075 UTSW Dscc1 0.957 PIT4498001 G1 168.01 N 15 55082315 V328D A T missense Het probably benign 0.001 phenotype 06/07/2019
8 556077 UTSW Epha3 0.270 PIT4498001 G1 225.01 N 16 63552526 Y938C T C missense Het probably damaging 1.000 phenotype 06/07/2019
9 556063 UTSW Erc1 1.000 PIT4498001 G1 225.01 N 6 119779491 F435I A T missense Het possibly damaging 0.918 phenotype 06/07/2019
10 556059 UTSW Fbxl5 1.000 PIT4498001 G1 225.01 N 5 43750981 Y626C T C missense Het possibly damaging 0.728 phenotype 06/07/2019
11 556043 UTSW Fmn2 0.779 PIT4498001 G1 225.01 N 1 174612604 R1196G A G missense Het probably damaging 0.997 phenotype 06/07/2019
12 556055 UTSW Gabrr1 0.146 PIT4498001 G1 225.01 N 4 33160225 S303F C T missense Het probably damaging 1.000 phenotype 06/07/2019
13 556068 UTSW Ggt1 0.108 PIT4498001 G1 94.01 N 10 75578855 V169A T C missense Het possibly damaging 0.946 phenotype 06/07/2019
14 556048 UTSW Gm10800 0.285 PIT4498001 G1 126.1 N 2 98667016 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA frame shift Het probably null 06/07/2019
15 556058 UTSW Gm13084 0.072 PIT4498001 G1 225.01 N 4 143812836 E29G T C missense Het possibly damaging 0.632 06/07/2019
16 556074 UTSW Gm3182 PIT4498001 G1 225.01 N 14 4481832 C9S T A missense Het probably damaging 0.979 06/07/2019
17 556054 UTSW Gpr88 0.125 PIT4498001 G1 214.01 N 3 116252615 S16A A C missense Het unknown 06/07/2019
18 556076 UTSW Kalrn 0.933 PIT4498001 G1 159.01 N 16 34031582 M2076K A T missense Het possibly damaging 0.809 phenotype 06/07/2019
19 556053 UTSW Kcnd3 0.000 PIT4498001 G1 200.01 N 3 105658709 I402T T C missense Het probably damaging 0.990 phenotype 06/07/2019
20 556070 UTSW Mink1 0.000 PIT4498001 G1 225.01 N 11 70598888 D57G A G missense Het probably benign 0.048 phenotype 06/07/2019
21 556042 UTSW Ncl 0.963 PIT4498001 G1 225.01 N 1 86351440 T584A T C missense Het possibly damaging 0.610 phenotype 06/07/2019
22 556056 UTSW Nfx1 0.650 PIT4498001 G1 225.01 N 4 40977244 Q306L A T missense Het probably benign 0.000 phenotype 06/07/2019
23 556069 UTSW Ogdh 1.000 PIT4498001 G1 149.01 N 11 6340504 D374V A T missense Het probably benign 0.094 phenotype 06/07/2019
24 556047 UTSW Olfr1167 0.127 PIT4498001 G1 225.01 N 2 88149915 T35S T A missense Het probably benign 0.002 phenotype 06/07/2019
25 556050 UTSW Pak7 0.000 PIT4498001 G1 115.01 N 2 136083291 H697L T A missense Het probably damaging 0.999 phenotype 06/07/2019
26 556057 UTSW Pappa 0.647 PIT4498001 G1 225.01 N 4 65316232 C1425R T C missense Het probably damaging 0.999 phenotype 06/07/2019
27 556044 UTSW Rab3gap2 0.000 PIT4498001 G1 225.01 N 1 185281685 I1196N T A missense Het probably damaging 0.997 phenotype 06/07/2019
28 556052 UTSW Ralyl 0.147 PIT4498001 G1 225.01 N 3 14107239 D56V A T missense Het probably damaging 0.992 06/07/2019
29 556072 UTSW Scin 0.000 PIT4498001 G1 221.01 N 12 40069447 C T critical splice acceptor site Het probably null phenotype 06/07/2019
30 556071 UTSW Slc25a19 1.000 PIT4498001 G1 225.01 N 11 115623955 I69V T C missense Het possibly damaging 0.795 phenotype 06/07/2019
31 556081 UTSW Slc8a1 1.000 PIT4498001 G1 225.01 N 17 81648840 Y256* G T nonsense Het probably null phenotype 06/07/2019
32 556062 UTSW Smyd1 1.000 PIT4498001 G1 206.01 N 6 71219288 H372R T C missense Het probably benign 0.001 phenotype 06/07/2019
33 556064 UTSW St8sia1 0.062 PIT4498001 G1 200.01 N 6 142914122 T94A T C missense Het probably damaging 0.999 phenotype 06/07/2019
34 556049 UTSW Stard9 0.163 PIT4498001 G1 225.01 N 2 120697435 M1391K T A missense Het possibly damaging 0.857 06/07/2019
35 556067 UTSW Tlr9 0.105 PIT4498001 G1 169.01 N 9 106223522 R4H G A missense Het probably benign 0.005 phenotype 06/07/2019
36 556060 UTSW Trim50 0.000 PIT4498001 G1 119.01 N 5 135353477 D61G A G missense Het probably damaging 1.000 phenotype 06/07/2019
37 556046 UTSW Ttn 1.000 PIT4498001 G1 225.01 N 2 76766951 P19873S G A missense Het probably damaging 1.000 phenotype 06/07/2019
38 556080 UTSW Vmn1r228 0.078 PIT4498001 G1 225.01 N 17 20776510 H249N G T missense Het probably benign 0.003 06/07/2019
39 556079 UTSW Vmn2r108 0.074 PIT4498001 G1 225.01 N 17 20463017 G642S C T missense Het probably damaging 1.000 06/07/2019
40 556078 UTSW Wdr27 0.089 PIT4498001 G1 225.01 N 17 14934569 S29P A G missense Het probably benign 0.006 phenotype 06/07/2019
41 556061 UTSW Zan 0.094 PIT4498001 G1 225.01 N 5 137417036 A G critical splice donor site 2 bp Het probably null phenotype 06/07/2019
[records 1 to 41 of 41]