Incidental Mutations

127 incidental mutations are currently displayed, and affect 127 genes.
16 are Possibly Damaging.
44 are Probably Damaging.
56 are Probably Benign.
10 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 127] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 25028 UTSW 4930402F06Rik 0.000 R0309 G1 225 Y 2 35376259 D133G T C missense Het possibly damaging 0.896 0.179 04/16/2013
2 65221 UTSW Abcb4 0.000 R0309 G1 143 Y 5 8939835 D796A A C missense Het probably damaging 0.999 0.551 phenotype 08/08/2013
3 25057 UTSW Actg2 0.000 R0309 G1 225 Y 6 83519914 V147E A T missense Het probably damaging 0.999 0.969 phenotype 04/16/2013
4 25026 UTSW Adamts13 0.103 R0309 G1 225 Y 2 26986989 T534P A C missense Het probably damaging 0.993 0.086 phenotype 04/16/2013
5 25044 UTSW Ago1 0.676 R0309 G1 225 Y 4 126443166 T249A T C missense Het probably benign 0.059 0.079 phenotype 04/16/2013
6 25163 UTSW Ahnak 0.324 R0309 G1 225 Y 19 9002495 I381N T A missense Het probably damaging 0.999 0.087 phenotype 04/16/2013
7 25046 UTSW Akap9 0.439 R0309 G1 191 Y 5 4069038 D3515G A G missense Het probably benign 0.013 0.090 phenotype 04/16/2013
8 25039 UTSW Angptl3 0.320 R0309 G1 225 Y 4 99034469 V249A T C missense Het probably benign 0.317 0.090 phenotype 04/16/2013
9 25115 UTSW Ank 0.469 R0309 G1 225 Y 15 27567572 T294A A G missense Het possibly damaging 0.647 0.763 phenotype 04/16/2013
10 25071 UTSW Ank1 0.403 R0309 G1 195 Y 8 23104809 H204L A T missense Het probably damaging 1.000 0.640 phenotype 04/16/2013
11 25049 UTSW Apbb2 0.000 R0309 G1 225 Y 5 66310988 A G splice site Het probably benign phenotype 04/16/2013
12 25147 UTSW Arhgap28 0.000 R0309 G1 220 Y 17 67901429 S15T A T missense Het probably benign 0.133 0.079 phenotype 04/16/2013
13 25020 UTSW Aspm 0.000 R0309 G1 164 Y 1 139482511 T C splice site Het probably benign phenotype 04/16/2013
14 25023 UTSW Atp1a4 0.000 R0309 G1 225 Y 1 172234987 E651G T C missense Het probably damaging 0.995 0.619 phenotype 04/16/2013
15 25091 UTSW B3gnt2 0.952 R0309 G1 225 Y 11 22836860 F109L A T missense Het probably damaging 0.975 0.472 phenotype 04/16/2013
16 25032 UTSW Bpifb4 0.055 R0309 G1 225 Y 2 153959683 F575L T C missense Het probably damaging 0.972 0.149 04/16/2013
17 25074 UTSW Calr 1.000 R0309 G1 225 Y 8 84843031 K322N C A missense Het probably benign 0.430 0.263 phenotype 04/16/2013
18 25130 UTSW Ccdc188 0.103 R0309 G1 225 Y 16 18219305 S247P T C missense Het possibly damaging 0.827 0.179 04/16/2013
19 261817 UTSW Cdr1 0.089 R0309 G1 126 N X 61185302 D86V T A missense Het unknown 02/04/2015
20 25133 UTSW Cep97 1.000 R0309 G1 205 Y 16 55925058 V48I C T missense Het probably damaging 0.964 0.647 04/16/2013
21 25137 UTSW Chaf1b 0.957 R0309 G1 225 Y 16 93884511 C6S T A missense Het probably damaging 0.964 0.393 phenotype 04/16/2013
22 25095 UTSW Chd3 0.000 R0309 G1 225 Y 11 69357018 D920N C T missense Het probably damaging 1.000 0.770 phenotype 04/16/2013
23 25016 UTSW Clk1 0.000 R0309 G1 225 Y 1 58413033 T C splice site Het probably benign phenotype 04/16/2013
24 25105 UTSW Cntnap3 0.061 R0309 G1 222 Y 13 64757436 T A splice site Het probably benign phenotype 04/16/2013
25 25078 UTSW Col12a1 0.708 R0309 G1 225 Y 9 79600011 T A unclassified 1748 bp Het probably null phenotype 04/16/2013
26 25181 UTSW Col17a1 0.000 R0309 G1 225 Y 19 47671362 G T splice site Het probably benign phenotype 04/16/2013
27 25068 UTSW Coq7 1.000 R0309 G1 225 Y 7 118529717 I32F T A missense Het possibly damaging 0.922 0.179 phenotype 04/16/2013
28 25069 UTSW Cox6a2 0.711 R0309 G1 225 Y 7 128205935 F59I A T missense Het probably damaging 0.997 0.669 phenotype 04/16/2013
29 25118 UTSW Cpq 0.569 R0309 G1 225 Y 15 33594151 D436G A G missense Het probably damaging 1.000 0.941 phenotype 04/16/2013
30 65218 UTSW Ctso 0.000 R0309 G1 114 Y 3 81944861 G A critical splice acceptor site Het probably null 0.959 phenotype 08/08/2013
31 25135 UTSW Cxadr 1.000 R0309 G1 225 Y 16 78334948 H274L A T missense Het probably benign 0.001 0.064 phenotype 04/16/2013
32 25169 UTSW Cyp2c40 0.409 R0309 G1 225 Y 19 39778051 C367S A T missense Het possibly damaging 0.510 0.289 04/16/2013
33 25172 UTSW Cyp2c70 0.082 R0309 G1 225 Y 19 40160671 M344L T G missense Het possibly damaging 0.941 0.304 04/16/2013
34 65222 UTSW Defa35 0.069 R0309 G1 152 N 8 21065855 V77I G A missense Het probably benign 0.424 08/08/2013
35 25149 UTSW Dhx57 0.194 R0309 G1 225 Y 17 80274881 Y432H A G missense Het probably damaging 0.999 0.172 04/16/2013
36 25022 UTSW Dhx9 1.000 R0309 G1 169 Y 1 153465695 D601E A T missense Het probably benign 0.002 0.070 phenotype 04/16/2013
37 25015 UTSW Dnah7a 0.148 R0309 G1 225 Y 1 53405690 D3952H C G missense Het probably damaging 0.974 0.318 04/16/2013
38 25093 UTSW Dnah9 0.380 R0309 G1 190 Y 11 66026972 C A splice site Het probably benign 0.090 phenotype 04/16/2013
39 25018 UTSW Dstyk 0.221 R0309 G1 219 Y 1 132456864 C A splice site Het probably benign phenotype 04/16/2013
40 65217 UTSW Efcab2 0.000 R0309 G1 156 Y 1 178475904 T A splice site Het probably benign phenotype 08/08/2013
41 25157 UTSW Ehbp1l1 1.000 R0309 G1 225 Y 19 5720570 E287G T C missense Het possibly damaging 0.719 0.103 phenotype 04/16/2013
42 25052 UTSW Epgn 0.000 R0309 G1 225 Y 5 91032214 T87A A G missense Het probably benign 0.059 0.113 phenotype 04/16/2013
43 25109 UTSW Erc2 0.000 R0309 G1 225 Y 14 28141225 E803A A C missense Het probably damaging 0.984 0.137 phenotype 04/16/2013
44 25079 UTSW Fam26d 0.064 R0309 G1 225 Y 10 34044047 W75R A G missense Het probably damaging 1.000 0.769 04/16/2013
45 25145 UTSW Fer 0.000 R0309 G1 225 Y 17 64139016 *454W A G makesense Het probably null 0.861 phenotype 04/16/2013
46 25126 UTSW Glyr1 0.416 R0309 G1 225 Y 16 5031972 D179G T C missense Het probably damaging 0.981 0.098 04/16/2013
47 25042 UTSW Gm12830 0.122 R0309 G1 213 Y 4 114844976 T A splice site Het probably benign 04/16/2013
48 25031 UTSW Gm14085 0.075 R0309 G1 225 Y 2 122517553 T253S A T missense Het probably benign 0.043 0.095 04/16/2013
49 25113 UTSW Gm9922 0.099 R0309 G1 186 Y 14 101729693 C A unclassified Het probably benign 0.090 04/16/2013
50 25013 UTSW Gsta3 0.110 R0309 G1 225 Y 1 21264894 P200S C T missense Het possibly damaging 0.916 0.449 phenotype 04/16/2013
51 25154 UTSW Hmgxb3 0.744 R0309 G1 225 Y 18 61155128 G A splice site Het probably benign 0.090 phenotype 04/16/2013
52 65223 UTSW Hsh2d 0.052 R0309 G1 225 Y 8 72200460 D229N G A missense Het probably benign 0.006 0.086 phenotype 08/08/2013
53 25065 UTSW Il16 0.220 R0309 G1 225 Y 7 83722554 K15E T C missense Het probably damaging 0.999 0.091 phenotype 04/16/2013
54 25175 UTSW Kcnip2 0.171 R0309 G1 225 Y 19 45794075 T A splice site Het probably benign phenotype 04/16/2013
55 25037 UTSW Kdm4c 0.000 R0309 G1 225 Y 4 74345567 V696A T C missense Het probably benign 0.002 0.090 phenotype 04/16/2013
56 25050 UTSW Kdr 1.000 R0309 G1 225 Y 5 75946927 A G splice site Het probably benign phenotype 04/16/2013
57 25111 UTSW Klhl33 0.186 R0309 G1 209 Y 14 50891411 H787P T G missense Het probably damaging 0.967 0.134 04/16/2013
58 25062 UTSW Klk14 0.000 R0309 G1 225 Y 7 43694345 T159S A T missense Het probably benign 0.012 0.090 phenotype 04/16/2013
59 25055 UTSW Lancl2 0.000 R0309 G1 194 Y 6 57703132 N16D A G missense Het probably damaging 0.998 0.425 04/16/2013
60 25085 UTSW Lemd3 1.000 R0309 G1 215 Y 10 120937110 N583S T C missense Het possibly damaging 0.707 0.179 phenotype 04/16/2013
61 66440 UTSW Map3k4 0.941 R0309 G1 122 Y 17 12271015 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG frame shift Het probably null phenotype 08/19/2013
62 25043 UTSW Mpl 0.000 R0309 G1 200 Y 4 118446038 T G intron Het probably benign phenotype 04/16/2013
63 25033 UTSW Myh7b 0.000 R0309 G1 225 Y 2 155630672 T C unclassified Het probably benign 0.090 phenotype 04/16/2013
64 25132 UTSW Mylk 0.000 R0309 G1 225 Y 16 34912297 A C splice site Het probably benign phenotype 04/16/2013
65 25166 UTSW Myof 0.000 R0309 G1 225 Y 19 37981266 M316K A T missense Het probably benign 0.119 0.458 phenotype 04/16/2013
66 25038 UTSW Nfib 1.000 R0309 G1 194 Y 4 82296737 N543I T A missense Het probably damaging 0.996 0.144 phenotype 04/16/2013
67 25073 UTSW Nfix 0.437 R0309 G1 225 Y 8 84721774 S375P A G missense Het probably damaging 1.000 0.180 phenotype 04/16/2013
68 25187 UTSW Nkrf 0.000 R0309 G1 222 Y X 36890116 Q171R T C missense Het probably damaging 0.999 0.180 phenotype 04/16/2013
69 25021 UTSW Nmnat2 1.000 R0309 G1 225 Y 1 153077001 T A splice site Het probably benign phenotype 04/16/2013
70 25051 UTSW Npffr2 0.000 R0309 G1 225 Y 5 89583347 E379K G A missense Het probably benign 0.002 0.082 phenotype 04/16/2013
71 65219 UTSW Npr2 0.859 R0309 G1 156 Y 4 43640904 T C unclassified Het probably benign phenotype 08/08/2013
72 25066 UTSW Nup98 1.000 R0309 G1 219 Y 7 102152428 D212E A C missense Het probably null 0.072 phenotype 04/16/2013
73 25048 UTSW Nwd2 0.120 R0309 G1 225 Y 5 63807218 Y1382H T C missense Het probably damaging 1.000 0.300 04/16/2013
74 25034 UTSW Ocstamp 0.000 R0309 G1 225 Y 2 165395992 R451G T C missense Het possibly damaging 0.745 0.179 phenotype 04/16/2013
75 25067 UTSW Olfr593 0.056 R0309 G1 225 Y 7 103212721 I287K T A missense Het probably damaging 0.999 0.647 phenotype 04/16/2013
76 25089 UTSW Olfr804 0.098 R0309 G1 225 Y 10 129705139 D87G A G missense Het probably benign 0.382 0.357 phenotype 04/16/2013
77 25120 UTSW Pabpc1 0.502 R0309 G1 225 Y 15 36597493 A551T C T missense Het possibly damaging 0.928 0.686 phenotype 04/16/2013
78 25107 UTSW Papd7 0.207 R0309 G1 225 Y 13 69499932 V781E A T missense Het possibly damaging 0.946 0.071 phenotype 04/16/2013
79 25076 UTSW Pard3 1.000 R0309 G1 225 Y 8 127376897 A T splice site Het probably benign 0.090 phenotype 04/16/2013
80 25151 UTSW Pcdhb12 0.066 R0309 G1 225 Y 18 37436121 V107L G T missense Het probably benign 0.000 0.090 04/16/2013
81 25045 UTSW Pik3cd 0.963 R0309 G1 225 Y 4 149663220 V22D A T missense Het probably damaging 1.000 0.853 phenotype 04/16/2013
82 65224 UTSW Pkd1l2 0.000 R0309 G1 87 Y 8 116997576 V2396A A G missense Het probably damaging 0.993 0.647 phenotype 08/08/2013
83 25025 UTSW Pnpla7 0.181 R0309 G1 225 Y 2 24987195 I167T T C missense Het probably damaging 0.997 0.245 phenotype 04/16/2013
84 25124 UTSW Pphln1 1.000 R0309 G1 176 Y 15 93441707 H114L A T missense Het possibly damaging 0.545 0.069 phenotype 04/16/2013
85 25087 UTSW Ppm1h 0.070 R0309 G1 225 Y 10 122920782 N444S A G missense Het probably damaging 0.996 0.183 04/16/2013
86 25139 UTSW Prdm9 0.358 R0309 G1 225 Y 17 15557384 T146I G A missense Het probably damaging 0.977 0.647 phenotype 04/16/2013
87 216059 UTSW Prrc2a 0.899 R0309 G1 57 Y 17 35150915 A G splice site Het probably benign phenotype 07/17/2014
88 65216 UTSW Prrx1 1.000 R0309 G1 139 Y 1 163312559 D26G T C missense Het possibly damaging 0.615 0.102 phenotype 08/08/2013
89 25064 UTSW Ptpn5 0.000 R0309 G1 217 Y 7 47079294 E495G T C missense Het probably damaging 0.973 0.359 phenotype 04/16/2013
90 25014 UTSW Rab23 1.000 R0309 G1 225 Y 1 33734861 A C splice site 3 bp Het probably null 0.976 phenotype 04/16/2013
91 25027 UTSW Ralgps1 0.362 R0309 G1 192 Y 2 33157923 M348I C T missense Het probably benign 0.000 0.060 phenotype 04/16/2013
92 25081 UTSW Ranbp2 1.000 R0309 G1 225 Y 10 58479868 T2137A A G missense Het probably benign 0.044 0.060 phenotype 04/16/2013
93 25030 UTSW Rapgef4 0.571 R0309 G1 225 Y 2 72226030 G654V G T missense Het probably benign 0.018 0.058 phenotype 04/16/2013
94 25029 UTSW Rc3h2 0.000 R0309 G1 225 Y 2 37379008 A T splice site Het probably benign phenotype 04/16/2013
95 25056 UTSW Reg2 0.000 R0309 G1 225 Y 6 78406186 A39T G A missense Het possibly damaging 0.896 0.179 phenotype 04/16/2013
96 25101 UTSW Sema4d 0.000 R0309 G1 173 Y 13 51725311 V7F C A missense Het probably benign 0.139 0.090 phenotype 04/16/2013
97 25040 UTSW Sgip1 0.000 R0309 G1 225 Y 4 102915157 T C splice site Het probably benign 0.090 phenotype 04/16/2013
98 25083 UTSW Sgpl1 1.000 R0309 G1 171 Y 10 61113437 C T critical splice donor site 1 bp Het probably null 0.959 phenotype 04/16/2013
99 25128 UTSW Shisa9 0.131 R0309 G1 225 Y 16 11997123 V212M G A missense Het probably damaging 0.999 0.647 phenotype 04/16/2013
100 25058 UTSW Shq1 0.955 R0309 G1 225 Y 6 100573627 P450L G A missense Het probably benign 0.009 0.090 phenotype 04/16/2013
[records 1 to 100 of 127] next >> last >|