Incidental Mutations

35 incidental mutations are currently displayed, and affect 34 genes.
4 are Possibly Damaging.
10 are Probably Damaging.
17 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 35 of 35] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 97419 UTSW Abcb5 0.149 R0988 G1 225 Y 12 118932575 I340V T C missense Het probably benign 0.360 0.083 phenotype 01/05/2014
2 97385 UTSW Ano1 1.000 R0988 G1 225 Y 7 144633653 S459R T G missense Het possibly damaging 0.942 0.376 phenotype 01/05/2014
3 97336 UTSW Cop1 0.515 R0988 G1 225 Y 1 159232847 V67A T C missense Het possibly damaging 0.759 0.182 phenotype 01/05/2014
4 97338 UTSW Cop1 0.515 R0988 G1 225 Y 1 159244672 Y186C A G missense Het probably damaging 0.995 0.425 phenotype 01/05/2014
5 97350 UTSW Cst11 0.056 R0988 G1 225 Y 2 148770426 T97I G A missense Het probably benign 0.264 0.090 phenotype 01/05/2014
6 97362 UTSW Ephb2 0.645 R0988 G1 225 Y 4 136659708 Y736F T A missense Het possibly damaging 0.589 0.578 phenotype 01/05/2014
7 97360 UTSW Extl1 0.382 R0988 G1 173 Y 4 134357677 TGCGTTGCACCGATACCGGG TG unclassified Het probably benign 0.090 phenotype 01/05/2014
8 97421 UTSW H2afy 0.000 R0988 G1 225 Y 13 56083296 T C critical splice acceptor site Het probably null 0.975 phenotype 01/05/2014
9 97342 UTSW Hmcn2 0.000 R0988 G1 225 Y 2 31335451 I124T T C missense Het probably damaging 1.000 0.126 01/05/2014
10 97379 UTSW Hpn 0.000 R0988 G1 225 Y 7 31099898 Y271C T C missense Het possibly damaging 0.761 0.170 phenotype 01/05/2014
11 97391 UTSW Kmt2a 1.000 R0988 G1 225 Y 9 44848549 S668P A G missense Het probably benign 0.033 0.058 phenotype 01/05/2014
12 97407 UTSW Krtap4-9 0.084 R0988 G1 105 Y 11 99785536 C94* T A nonsense Het probably null 0.976 01/05/2014
13 97415 UTSW Lgmn 0.000 R0988 G1 225 Y 12 102398277 D311G T C missense Het probably damaging 0.988 0.462 phenotype 01/05/2014
14 233275 UTSW Mfsd14b 0.139 R0988 G1 80 Y 13 65112493 T C splice site Het probably benign 0.090 09/18/2014
15 97399 UTSW Micu1 0.674 R0988 G1 157 Y 10 59756727 C A intron Het probably benign 0.090 phenotype 01/05/2014
16 97383 UTSW Muc5b 0.206 R0988 G1 225 Y 7 141871795 I4726V A G missense Het probably benign 0.029 0.079 phenotype 01/05/2014
17 97427 UTSW Nadk2 1.000 R0988 G1 225 Y 15 9102992 N310K T A missense Het probably damaging 0.987 0.728 phenotype 01/05/2014
18 97439 UTSW Napg 0.927 R0988 G1 225 Y 18 62983360 T C splice site Het probably benign phenotype 01/05/2014
19 97403 UTSW Nav3 0.000 R0988 G1 225 Y 10 109716528 R1818W G A missense Het probably damaging 0.999 0.296 phenotype 01/05/2014
20 97389 UTSW Ntpcr 0.107 R0988 G1 225 Y 8 125737431 T C splice site Het probably benign 0.090 phenotype 01/05/2014
21 97441 UTSW Olfr1451 0.176 R0988 G1 225 Y 19 12999787 D267G A G missense Het probably benign 0.391 0.242 phenotype 01/05/2014
22 97344 UTSW Olfr341 0.060 R0988 G1 225 Y 2 36479767 D121G T C missense Het probably damaging 1.000 0.368 phenotype 01/05/2014
23 97381 UTSW Olfr609 0.077 R0988 G1 225 Y 7 103492747 I44F T A missense Het probably damaging 0.999 0.244 phenotype 01/05/2014
24 97405 UTSW Olfr807 0.050 R0988 G1 225 Y 10 129754997 V151A A G missense Het probably benign 0.031 0.090 phenotype 01/05/2014
25 97435 UTSW Pdia2 0.095 R0988 G1 225 Y 17 26198829 F69L A G missense Het probably damaging 1.000 0.786 phenotype 01/05/2014
26 97395 UTSW Pik3r4 1.000 R0988 G1 225 Y 9 105687205 T1333A A G missense Het probably damaging 0.969 0.445 phenotype 01/05/2014
27 97346 UTSW Platr26 0.242 R0988 G1 165 Y 2 71723287 A T splice site Het noncoding transcript 01/05/2014
28 97437 UTSW Proc 1.000 R0988 G1 225 Y 18 32133483 D97G T C missense Het probably benign 0.000 0.090 phenotype 01/05/2014
29 97397 UTSW Ptpn23 1.000 R0988 G1 225 Y 9 110388777 R700H C T missense Het probably benign 0.017 0.090 phenotype 01/05/2014
30 262399 UTSW Rragc 0.431 R0988 G1 225 N 4 123924782 T A splice site Het probably null phenotype 02/04/2015
31 97433 UTSW Serac1 0.000 R0988 G1 225 Y 17 6061580 F244I A T missense Het probably benign 0.022 0.113 phenotype 01/05/2014
32 97401 UTSW Snrpd3 0.955 R0988 G1 225 Y 10 75532205 D52G A G missense Het probably damaging 0.993 0.690 phenotype 01/05/2014
33 97423 UTSW Thrb 0.413 R0988 G1 225 Y 14 17981837 G T intron Het probably benign 0.090 phenotype 01/05/2014
34 97411 UTSW Ttc6 0.139 R0988 G1 225 Y 12 57688649 T C splice site Het probably benign 01/05/2014
35 97377 UTSW Zfp607b 0.069 R0988 G1 225 Y 7 27702976 C286S T A missense Het probably benign 0.338 0.750 01/05/2014
[records 1 to 35 of 35]