Incidental Mutations

71 incidental mutations are currently displayed, and affect 71 genes.
12 are Possibly Damaging.
30 are Probably Damaging.
19 are Probably Benign.
8 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 71 of 71] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 161275 UTSW 4932438A13Rik 1.000 R1437 G1 225 N 3 36942429 H1097N C A missense Het possibly damaging 0.655 phenotype 03/14/2014
2 161283 UTSW Abcb1b 0.358 R1437 G1 225 N 5 8821436 V330E T A missense Het possibly damaging 0.904 phenotype 03/14/2014
3 161319 UTSW Abcb5 0.199 R1437 G1 225 N 12 118874762 S1022P A G missense Het probably damaging 0.994 phenotype 03/14/2014
4 161297 UTSW Abcc8 0.619 R1437 G1 141 N 7 46179813 I46T A G missense Het probably damaging 1.000 phenotype 03/14/2014
5 161343 UTSW Add3 0.000 R1437 G1 225 N 19 53233678 R275G A G missense Het probably damaging 0.980 phenotype 03/14/2014
6 161314 UTSW Akap1 0.000 R1437 G1 225 N 11 88844751 G362* C A nonsense Het probably null 0.976 phenotype 03/14/2014
7 161264 UTSW Arhgef4 0.000 R1437 G1 225 N 1 34723945 T761A A G missense Het unknown phenotype 03/14/2014
8 161327 UTSW Asap1 0.185 R1437 G1 225 N 15 64120107 L751Q A T missense Het probably damaging 0.960 phenotype 03/14/2014
9 161341 UTSW Atg2a 0.642 R1437 G1 225 N 19 6250616 P741H C A missense Het probably damaging 1.000 03/14/2014
10 161329 UTSW Atxn10 1.000 R1437 G1 225 N 15 85359474 I46T T C missense Het possibly damaging 0.466 phenotype 03/14/2014
11 161291 UTSW BC049715 0.000 R1437 G1 103 N 6 136840092 A110E C A missense Het probably damaging 0.993 03/14/2014
12 161317 UTSW Btbd7 0.405 R1437 G1 225 N 12 102788090 T806S T A missense Het possibly damaging 0.587 03/14/2014
13 161311 UTSW Cdk4 0.917 R1437 G1 225 N 10 127064689 P108H C A missense Het probably damaging 1.000 phenotype 03/14/2014
14 161310 UTSW Cep290 0.907 R1437 G1 225 N 10 100572101 T2391A A G missense Het probably benign 0.001 phenotype 03/14/2014
15 161265 UTSW Col6a3 0.000 R1437 G1 109 N 1 90801376 A1281E G T missense Het probably damaging 0.999 phenotype 03/14/2014
16 161290 UTSW Cpa5 0.134 R1437 G1 210 N 6 30624655 I165F A T missense Het probably damaging 1.000 phenotype 03/14/2014
17 161340 UTSW Ctdp1 0.954 R1437 G1 225 N 18 80450213 Q356K G T missense Het probably benign 0.012 phenotype 03/14/2014
18 161308 UTSW Ddx21 1.000 R1437 G1 225 N 10 62598590 M130T A G missense Het unknown phenotype 03/14/2014
19 161284 UTSW Epha5 0.000 R1437 G1 225 N 5 84233696 D432A T G missense Het probably damaging 1.000 phenotype 03/14/2014
20 161304 UTSW Esr1 0.884 R1437 G1 116 N 10 4712571 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC small deletion Het probably benign phenotype 03/14/2014
21 161342 UTSW Fads2 0.793 R1437 G1 225 N 19 10091829 L77Q A T missense Het probably benign 0.002 phenotype 03/14/2014
22 161339 UTSW Fbn2 0.833 R1437 G1 225 N 18 58053659 H1723Q A T missense Het possibly damaging 0.676 phenotype 03/14/2014
23 161281 UTSW Fbxo42 0.445 R1437 G1 225 N 4 141167854 H43Y C T missense Het probably benign 0.001 phenotype 03/14/2014
24 161288 UTSW Fry 0.694 R1437 G1 225 N 5 150310425 T121A A G missense Het possibly damaging 0.921 03/14/2014
25 161331 UTSW Gpr156 0.000 R1437 G1 225 N 16 37988542 S209A T G missense Het probably damaging 0.987 phenotype 03/14/2014
26 161306 UTSW Hey2 0.886 R1437 G1 225 N 10 30833849 T303A T C missense Het probably benign 0.001 phenotype 03/14/2014
27 161321 UTSW Hivep1 0.604 R1437 G1 225 N 13 42157140 M952K T A missense Het probably benign 0.026 phenotype 03/14/2014
28 161330 UTSW Hrasls 0.070 R1437 G1 225 N 16 29228170 A147E C A missense Het possibly damaging 0.776 03/14/2014
29 161300 UTSW Hydin 0.603 R1437 G1 225 N 8 110581985 Q3968* C T nonsense Het probably null phenotype 03/14/2014
30 161315 UTSW Jup 1.000 R1437 G1 225 N 11 100383576 E96G T C missense Het probably benign 0.063 phenotype 03/14/2014
31 161299 UTSW Kcnn1 0.000 R1437 G1 225 N 8 70844551 I504T A G missense Het probably benign 0.032 phenotype 03/14/2014
32 161295 UTSW Klk1b9 0.111 R1437 G1 225 N 7 43979690 V174A T C missense Het probably damaging 0.995 phenotype 03/14/2014
33 161338 UTSW Lama3 1.000 R1437 G1 225 N 18 12549227 M1083I G C missense Het possibly damaging 0.462 phenotype 03/14/2014
34 161274 UTSW Lcmt2 0.080 R1437 G1 225 N 2 121138896 S569P A G missense Het probably benign 0.060 0.144 phenotype 03/14/2014
35 161336 UTSW Lrfn2 0.000 R1437 G1 155 N 17 49071225 S445P T C missense Het probably damaging 0.974 phenotype 03/14/2014
36 161294 UTSW Lrp3 0.133 R1437 G1 225 N 7 35213170 G31W C A missense Het probably damaging 1.000 03/14/2014
37 161286 UTSW Lrrc8b 0.173 R1437 G1 225 N 5 105481702 L638P T C missense Het probably damaging 1.000 03/14/2014
38 161313 UTSW Mief2 0.378 R1437 G1 225 N 11 60730943 T113M C T missense Het probably benign 0.013 phenotype 03/14/2014
39 161269 UTSW Mrps2 0.931 R1437 G1 225 N 2 28468887 F76S T C missense Het probably damaging 0.999 phenotype 03/14/2014
40 161312 UTSW Naca 0.652 R1437 G1 225 N 10 128042179 A G intron Het probably benign phenotype 03/14/2014
41 161278 UTSW Ndst4 0.113 R1437 G1 225 N 3 125561450 R336S C A missense Het probably damaging 0.966 phenotype 03/14/2014
42 161268 UTSW Nr1i3 0.000 R1437 G1 118 N 1 171217141 CACTCAACACTAC CAC frame shift Het probably null phenotype 03/14/2014
43 161270 UTSW Nr5a1 1.000 R1437 G1 225 N 2 38710673 T29S T A missense Het probably benign 0.000 phenotype 03/14/2014
44 161273 UTSW Olfr1111 0.195 R1437 G1 225 N 2 87149771 V297M C T missense Het possibly damaging 0.937 phenotype 03/14/2014
45 161272 UTSW Olfr993 0.192 R1437 G1 225 N 2 85414874 I2V T C missense Het probably benign 0.012 phenotype 03/14/2014
46 161307 UTSW Pald1 0.110 R1437 G1 225 N 10 61341285 F662S A G missense Het possibly damaging 0.633 03/14/2014
47 161344 UTSW Pdcd4 0.352 R1437 G1 225 N 19 53909243 A59S G T missense Het probably damaging 0.993 phenotype 03/14/2014
48 161301 UTSW Pde4a 0.209 R1437 G1 100 N 9 21192592 T C critical splice donor site 2 bp Het probably null phenotype 03/14/2014
49 161334 UTSW Pkd1 1.000 R1437 G1 206 N 17 24595132 S4159T T A missense Het probably damaging 0.999 phenotype 03/14/2014
50 161276 UTSW Plch1 0.171 R1437 G1 223 N 3 63697533 R1641L C A missense Het probably benign 0.369 phenotype 03/14/2014
51 161328 UTSW Plec 0.891 R1437 G1 225 N 15 76189281 P308Q G T missense Het probably damaging 0.993 phenotype 03/14/2014
52 161296 UTSW Pnkp 0.960 R1437 G1 192 N 7 44860402 S262G A G missense Het possibly damaging 0.872 phenotype 03/14/2014
53 161267 UTSW Pou2f1 1.000 R1437 G1 215 N 1 165891830 V504A A G missense Het probably damaging 0.976 phenotype 03/14/2014
54 161337 UTSW Prepl 0.216 R1437 G1 225 N 17 85088357 R66W G A missense Het probably damaging 0.999 phenotype 03/14/2014
55 161324 UTSW Rasgrf2 0.187 R1437 G1 225 N 13 92030888 K226E T C missense Het probably damaging 0.999 phenotype 03/14/2014
56 161280 UTSW Ror1 1.000 R1437 G1 225 N 4 100412109 F381L T A missense Het probably benign 0.000 phenotype 03/14/2014
57 161292 UTSW Sbsn 0.064 R1437 G1 225 N 7 30753053 Q498* C T nonsense Het probably null 03/14/2014
58 161293 UTSW Scgb2b19 0.033 R1437 G1 225 N 7 33278555 I106V T C missense Het probably benign 0.080 03/14/2014
59 161309 UTSW Sf3a2 0.958 R1437 G1 142 N 10 80804206 G A unclassified Het probably benign 0.070 03/14/2014
60 161277 UTSW Sis 0.000 R1437 G1 225 N 3 72934142 H780R T C missense Het probably damaging 1.000 phenotype 03/14/2014
61 161322 UTSW Slc28a3 0.000 R1437 G1 218 N 13 58558575 C617* G T nonsense Het probably null phenotype 03/14/2014
62 161279 UTSW Slc44a1 0.000 R1437 G1 225 N 4 53561006 V574D T A missense Het probably damaging 1.000 03/14/2014
63 161316 UTSW Slc8a3 0.000 R1437 G1 225 N 12 81315986 T20S T A missense Het probably damaging 0.989 0.071 phenotype 03/14/2014
64 161303 UTSW Stt3b 0.861 R1437 G1 225 N 9 115254927 I394F T A missense Het probably damaging 1.000 phenotype 03/14/2014
65 161302 UTSW Ubap1l 0.000 R1437 G1 185 N 9 65372055 V212D T A missense Het possibly damaging 0.600 03/14/2014
66 161285 UTSW Ugt2b35 0.060 R1437 G1 225 N 5 87001031 V47A T C missense Het probably benign 0.017 03/14/2014
67 161333 UTSW Vmn2r114 0.078 R1437 G1 87 N 17 23291211 F765S A G missense Het probably damaging 1.000 03/14/2014
68 161289 UTSW Vps50 0.817 R1437 G1 225 N 6 3517852 Q97* C T nonsense Het probably null 03/14/2014
69 161287 UTSW Vsig10 0.067 R1437 G1 225 N 5 117351570 Q467R A G missense Het probably damaging 0.957 03/14/2014
70 161271 UTSW Wdsub1 0.138 R1437 G1 151 N 2 59878133 Y11S T G missense Het probably damaging 0.977 03/14/2014
71 161332 UTSW Zbtb11 0.969 R1437 G1 225 N 16 55991620 T G critical splice donor site 2 bp Het probably null 03/14/2014
[records 1 to 71 of 71]