Incidental Mutations

79 incidental mutations are currently displayed, and affect 79 genes.
11 are Possibly Damaging.
39 are Probably Damaging.
23 are Probably Benign.
5 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 79 of 79] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 194428 UTSW 4933403O08Rik 0.029 R1766 G1 222 N X 112241085 Y22H T C missense Het probably benign 0.021 05/23/2014
2 194385 UTSW Afg1l 0.151 R1766 G1 225 N 10 42454495 T59A T C missense Het probably benign 0.001 phenotype 05/23/2014
3 194357 UTSW Ankrd17 1.000 R1766 G1 225 N 5 90264797 M1223L T A missense Het possibly damaging 0.946 phenotype 05/23/2014
4 194386 UTSW Ankrd24 0.438 R1766 G1 225 N 10 81638638 S68N G A missense Het probably benign 0.129 05/23/2014
5 194414 UTSW Arhgap31 0.278 R1766 G1 225 N 16 38625590 I131T A G missense Het probably damaging 1.000 phenotype 05/23/2014
6 194373 UTSW Arhgef10 0.000 R1766 G1 225 N 8 14979836 I874F A T missense Het probably damaging 0.999 phenotype 05/23/2014
7 194336 UTSW Arl5b 0.063 R1766 G1 225 N 2 15069837 V43A T C missense Het probably benign 0.359 phenotype 05/23/2014
8 194398 UTSW BC051665 0.181 R1766 G1 225 N 13 60785040 H36Y G A missense Het probably benign 0.003 05/23/2014
9 194405 UTSW Cdh9 0.167 R1766 G1 225 N 15 16778306 D69G A G missense Het probably damaging 0.999 phenotype 05/23/2014
10 194340 UTSW Chd6 0.770 R1766 G1 225 N 2 160966639 L1552F G A missense Het probably damaging 0.999 phenotype 05/23/2014
11 194413 UTSW Chrd 1.000 R1766 G1 225 N 16 20737441 H584R A G missense Het probably damaging 0.999 phenotype 05/23/2014
12 194368 UTSW Dnhd1 0.103 R1766 G1 225 N 7 105693972 V1508I G A missense Het possibly damaging 0.505 05/23/2014
13 194350 UTSW Dpy19l4 0.091 R1766 G1 225 N 4 11303360 G187D C T missense Het probably damaging 1.000 05/23/2014
14 194375 UTSW Dync2h1 1.000 R1766 G1 225 N 9 7015526 T C critical splice acceptor site Het probably null phenotype 05/23/2014
15 194422 UTSW Ehbp1l1 1.000 R1766 G1 167 N 19 5716406 V1303A A G missense Het probably damaging 0.978 phenotype 05/23/2014
16 194397 UTSW Eif4e1b 0.000 R1766 G1 225 N 13 54786891 E182K G A missense Het probably damaging 0.977 05/23/2014
17 194402 UTSW Fam170b 0.060 R1766 G1 225 N 14 32835886 Q226L A T missense Het possibly damaging 0.938 05/23/2014
18 194356 UTSW Fam193a 0.200 R1766 G1 225 N 5 34462131 P760L C T missense Het probably damaging 0.994 05/23/2014
19 194366 UTSW Gabra5 0.254 R1766 G1 225 N 7 57508048 L6H A T missense Het probably benign 0.055 phenotype 05/23/2014
20 194427 UTSW Gabrq R1766 G1 222 N X 72833383 R161H G A missense Het probably damaging 1.000 phenotype 05/23/2014
21 194381 UTSW Gm10608 0.082 R1766 G1 111 N 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA frame shift Het probably null 05/23/2014
22 194418 UTSW Gm7334 0.349 R1766 G1 225 N 17 50698978 D97E T A missense Het probably damaging 0.999 05/23/2014
23 194337 UTSW Gpsm1 0.000 R1766 G1 203 N 2 26325383 A286T G A missense Het probably damaging 0.999 phenotype 05/23/2014
24 194380 UTSW Gsta4 0.000 R1766 G1 225 N 9 78204329 Y79* C A nonsense Het probably null phenotype 05/23/2014
25 194401 UTSW Hcn1 0.000 R1766 G1 225 N 13 117656734 V174D T A missense Het probably benign 0.387 phenotype 05/23/2014
26 194392 UTSW Hic1 0.451 R1766 G1 171 N 11 75165794 C756* G T nonsense Het probably null phenotype 05/23/2014
27 194352 UTSW Hivep3 0.000 R1766 G1 225 N 4 120096671 T728I C T missense Het probably benign 0.000 phenotype 05/23/2014
28 194399 UTSW Ice1 0.927 R1766 G1 225 N 13 70604442 E1175G T C missense Het possibly damaging 0.778 05/23/2014
29 194346 UTSW Igsf3 0.352 R1766 G1 225 N 3 101431282 L304Q T A missense Het probably damaging 0.999 phenotype 05/23/2014
30 194353 UTSW Kpna6 0.000 R1766 G1 225 N 4 129657442 D90G T C missense Het probably benign 0.327 phenotype 05/23/2014
31 194411 UTSW Krt73 0.132 R1766 G1 225 N 15 101793928 G500D C T missense Het probably damaging 1.000 phenotype 05/23/2014
32 194421 UTSW Lama3 1.000 R1766 G1 225 N 18 12402062 K156E A G missense Het probably damaging 1.000 phenotype 05/23/2014
33 194387 UTSW Mdm2 1.000 R1766 G1 225 N 10 117696022 K94E T C missense Het probably damaging 0.999 phenotype 05/23/2014
34 194362 UTSW Mitf 0.916 R1766 G1 225 N 6 97941099 S26P T C missense Het probably damaging 0.998 phenotype 05/23/2014
35 194391 UTSW Myh4 0.345 R1766 G1 225 N 11 67256295 Q1589K C A missense Het possibly damaging 0.610 phenotype 05/23/2014
36 194363 UTSW Nlrp4c 0.064 R1766 G1 225 N 7 6073114 V671E T A missense Het probably benign 0.003 05/23/2014
37 194404 UTSW Nop9 0.956 R1766 G1 225 N 14 55752134 A407V C T missense Het possibly damaging 0.945 05/23/2014
38 194426 UTSW Nrap 0.000 R1766 G1 225 N 19 56335042 H1366L T A missense Het probably damaging 0.988 05/23/2014
39 194343 UTSW Ntrk1 1.000 R1766 G1 152 N 3 87778518 C766S A T missense Het probably damaging 1.000 phenotype 05/23/2014
40 194367 UTSW Olfr625-ps1 0.066 R1766 G1 225 N 7 103682861 N38D A G missense Het possibly damaging 0.499 05/23/2014
41 194403 UTSW Olfr735 0.168 R1766 G1 225 N 14 50346220 Y43C T C missense Het probably damaging 1.000 phenotype 05/23/2014
42 194388 UTSW Olfr768 0.059 R1766 G1 225 N 10 129093747 I76V T C missense Het probably benign 0.244 phenotype 05/23/2014
43 194376 UTSW Olfr845 0.142 R1766 G1 225 N 9 19338858 T133A A G missense Het probably benign 0.057 phenotype 05/23/2014
44 194354 UTSW Oog3 0.068 R1766 G1 225 N 4 144159122 G302D C T missense Het possibly damaging 0.490 05/23/2014
45 194419 UTSW Pdzph1 0.115 R1766 G1 225 N 17 58973752 V512I C T missense Het probably benign 0.162 05/23/2014
46 194396 UTSW Phf2 0.560 R1766 G1 225 N 13 48819557 S408A A C missense Het unknown phenotype 05/23/2014
47 194348 UTSW Pigk 0.828 R1766 G1 225 N 3 152740156 L135V T G missense Het probably damaging 1.000 phenotype 05/23/2014
48 194390 UTSW Ppp2ca 1.000 R1766 G1 225 N 11 52121946 T301N C A missense Het probably benign 0.000 phenotype 05/23/2014
49 194395 UTSW Ppp4r3a 0.383 R1766 G1 225 N 12 101058482 S253P A G missense Het probably damaging 0.988 05/23/2014
50 194345 UTSW Ptgfrn 0.000 R1766 G1 225 N 3 101050122 I712N A T missense Het probably benign 0.004 phenotype 05/23/2014
51 194342 UTSW Rapgef2 1.000 R1766 G1 225 N 3 79092703 D579E A T missense Het probably damaging 1.000 phenotype 05/23/2014
52 194406 UTSW Rims2 0.592 R1766 G1 225 N 15 39462580 D769E T A missense Het probably damaging 0.990 phenotype 05/23/2014
53 194394 UTSW Rptor 1.000 R1766 G1 225 N 11 119725061 C134S T A missense Het probably damaging 0.994 phenotype 05/23/2014
54 194344 UTSW S100a1 R1766 G1 225 N 3 90511292 F72L A G missense Het probably damaging 1.000 phenotype 05/23/2014
55 194409 UTSW Scube1 0.191 R1766 G1 225 N 15 83721945 D42V T A missense Het probably damaging 1.000 phenotype 05/23/2014
56 194347 UTSW Sh3glb1 0.716 R1766 G1 225 N 3 144712685 D39G T C missense Het probably damaging 1.000 phenotype 05/23/2014
57 194424 UTSW Sh3pxd2a 1.000 R1766 G1 175 N 19 47273250 T397A T C missense Het probably benign 0.010 phenotype 05/23/2014
58 194364 UTSW Siglece 0.059 R1766 G1 225 N 7 43651532 T453M G A missense Het probably damaging 0.993 phenotype 05/23/2014
59 194360 UTSW Slc26a1 0.242 R1766 G1 225 N 5 108671792 R514W G A missense Het probably damaging 0.996 phenotype 05/23/2014
60 194410 UTSW Slc4a8 0.257 R1766 G1 216 N 15 100787212 V156A T C missense Het probably benign 0.002 phenotype 05/23/2014
61 194420 UTSW Smchd1 0.813 R1766 G1 225 N 17 71391379 V1134E A T missense Het probably damaging 0.988 phenotype 05/23/2014
62 194374 UTSW Sorbs2 0.000 R1766 G1 225 N 8 45770576 Y222C A G missense Het probably damaging 1.000 phenotype 05/23/2014
63 194425 UTSW Sorcs3 0.136 R1766 G1 165 N 19 48603875 W326C G T missense Het possibly damaging 0.869 phenotype 05/23/2014
64 194407 UTSW Taf2 1.000 R1766 G1 225 N 15 55071397 V45A A G missense Het probably benign 0.008 phenotype 05/23/2014
65 194341 UTSW Tiparp 0.808 R1766 G1 225 N 3 65532049 H80L A T missense Het probably damaging 1.000 phenotype 05/23/2014
66 194408 UTSW Tmem71 0.069 R1766 G1 225 N 15 66541699 T175S T A missense Het probably benign 0.002 05/23/2014
67 194338 UTSW Tmem87b 0.000 R1766 G1 225 N 2 128839170 V338D T A missense Het probably damaging 0.960 phenotype 05/23/2014
68 194384 UTSW Trdn 0.071 R1766 G1 225 N 10 33364008 K445R A G missense Het probably damaging 0.997 phenotype 05/23/2014
69 194351 UTSW Trim14 0.000 R1766 G1 225 N 4 46522039 F213L A G missense Het probably benign 0.002 phenotype 05/23/2014
70 194365 UTSW Tubgcp5 0.961 R1766 G1 225 N 7 55815020 S550T T A missense Het probably benign 0.149 05/23/2014
71 194371 UTSW Tufm 0.950 R1766 G1 216 N 7 126490472 D446G A G missense Het probably benign 0.097 phenotype 05/23/2014
72 194382 UTSW Vipr1 1.000 R1766 G1 225 N 9 121661419 Y177F A T missense Het possibly damaging 0.870 phenotype 05/23/2014
73 194415 UTSW Vmn2r116 0.068 R1766 G1 225 N 17 23401766 I825L A C missense Het probably damaging 0.983 phenotype 05/23/2014
74 194361 UTSW Vmn2r12 0.091 R1766 G1 225 N 5 109092044 Q218K G T missense Het probably damaging 0.999 05/23/2014
75 194417 UTSW Vwa7 0.055 R1766 G1 225 N 17 35023943 G T critical splice donor site 1 bp Het probably null 05/23/2014
76 194393 UTSW Ywhae 1.000 R1766 G1 225 N 11 75755665 V119A T C missense Het probably damaging 1.000 phenotype 05/23/2014
77 194423 UTSW Zfand5 0.809 R1766 G1 225 N 19 21280524 R199G A G missense Het probably damaging 0.998 phenotype 05/23/2014
78 194378 UTSW Zfp810 0.096 R1766 G1 225 N 9 22278532 Y360C T C missense Het possibly damaging 0.644 05/23/2014
79 194389 UTSW Zrsr1 0.000 R1766 G1 225 N 11 22973637 D137G A G missense Het probably benign 0.004 phenotype 05/23/2014
[records 1 to 79 of 79]