Incidental Mutations

87 incidental mutations are currently displayed, and affect 86 genes.
12 are Possibly Damaging.
30 are Probably Damaging.
30 are Probably Benign.
13 are Probably Null.
8 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 87 of 87] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 213057 UTSW 9030624J02Rik 0.170 R1921 G1 225 N 7 118833748 N568S A G missense Het probably damaging 0.981 07/14/2014
2 213050 UTSW A2m 0.000 R1921 G1 225 N 6 121654612 L623M C A missense Het probably benign 0.043 0.090 phenotype 07/14/2014
3 213055 UTSW Abhd2 0.442 R1921 G1 225 N 7 79348356 I212T T C missense Het possibly damaging 0.829 phenotype 07/14/2014
4 213092 UTSW Adam7 0.063 R1921 G1 225 N 14 68512625 S449A A C missense Het possibly damaging 0.548 phenotype 07/14/2014
5 213046 UTSW Alkbh2 0.000 R1921 G1 213 N 5 114124226 E148K C T missense Het probably damaging 0.979 0.223 phenotype 07/14/2014
6 213013 UTSW Aox3 0.000 R1921 G1 225 N 1 58180651 Y1137H T C missense Het probably damaging 1.000 07/14/2014
7 213034 UTSW Atp11b 0.309 R1921 G1 225 N 3 35834325 Y715H T C missense Het probably damaging 1.000 phenotype 07/14/2014
8 213027 UTSW Atrn 0.000 R1921 G1 225 N 2 130995051 Y1145C A G missense Het probably damaging 1.000 0.943 phenotype 07/14/2014
9 213086 UTSW Btbd7 0.304 R1921 G1 225 N 12 102793796 I631T A G missense Het probably benign 0.008 07/14/2014
10 213087 UTSW Cadps 1.000 R1921 G1 225 N 14 12465859 K1017R T C missense Het possibly damaging 0.638 0.060 phenotype 07/14/2014
11 213018 UTSW Cfap45 0.378 R1921 G1 225 N 1 172545112 E458G A G missense Het probably damaging 0.995 07/14/2014
12 213041 UTSW Cptp 0.196 R1921 G1 225 N 4 155866538 R157H C T missense Het probably damaging 1.000 07/14/2014
13 213075 UTSW Dcbld1 0.000 R1921 G1 225 N 10 52319651 E318D A C missense Het possibly damaging 0.944 07/14/2014
14 213017 UTSW Ddr2 0.000 R1921 G1 225 N 1 170004245 P197Q G T missense Het probably damaging 1.000 phenotype 07/14/2014
15 213089 UTSW Dlg5 1.000 R1921 G1 221 N 14 24176571 Y421C T C missense Het probably damaging 0.999 0.337 phenotype 07/14/2014
16 213059 UTSW Dlgap2 0.000 R1921 G1 225 N 8 14843624 K980E A G missense Het probably benign 0.101 phenotype 07/14/2014
17 213062 UTSW Drc7 0.000 R1921 G1 225 N 8 95056016 V3A T C missense Het unknown 07/14/2014
18 213010 UTSW Dst 0.276 R1921 G1 225 N 1 34161029 V96A T C missense Het probably damaging 0.990 0.132 phenotype 07/14/2014
19 213073 UTSW Ect2l 0.109 R1921 G1 225 N 10 18143004 D548G T C missense Het possibly damaging 0.895 07/14/2014
20 213084 UTSW Efcab10 0.502 R1921 G1 225 N 12 33398435 Y89F A T missense Het probably benign 0.124 07/14/2014
21 213109 UTSW Eif1ad 1.000 R1921 G1 134 N 19 5370058 CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG unclassified Het probably benign 07/14/2014
22 213029 UTSW Entpd6 0.000 R1921 G1 225 N 2 150758812 T147A A G missense Het probably damaging 1.000 phenotype 07/14/2014
23 213043 UTSW Fbxl5 1.000 R1921 G1 225 N 5 43765490 E189D T A missense Het probably benign 0.164 phenotype 07/14/2014
24 213093 UTSW Fer1l6 0.079 R1921 G1 225 N 15 58625231 S1217T T A missense Het probably damaging 1.000 07/14/2014
25 213035 UTSW Frem2 1.000 R1921 G1 225 N 3 53653495 V1197D A T missense Het possibly damaging 0.762 phenotype 07/14/2014
26 213021 UTSW Fsip2 0.108 R1921 G1 225 N 2 82980783 L2482* T A nonsense Het probably null phenotype 07/14/2014
27 213022 UTSW Fsip2 0.108 R1921 G1 225 N 2 82986820 D4299V A T missense Het probably benign 0.035 0.090 phenotype 07/14/2014
28 213079 UTSW Gipc3 0.000 R1921 G1 225 N 10 81338215 I242F T A missense Het probably damaging 0.993 phenotype 07/14/2014
29 213082 UTSW Hoxb1 1.000 R1921 G1 225 N 11 96366112 Y96N T A missense Het probably damaging 0.987 phenotype 07/14/2014
30 213045 UTSW Ibsp 0.101 R1921 G1 225 N 5 104310212 E205G A G missense Het probably damaging 0.999 phenotype 07/14/2014
31 213071 UTSW Ibtk 0.000 R1921 G1 225 N 9 85703082 S1170P A G missense Het probably benign 0.000 phenotype 07/14/2014
32 213016 UTSW Igfn1 0.098 R1921 G1 191 N 1 135966063 A G critical splice donor site 2 bp Het probably null 07/14/2014
33 213049 UTSW Iqsec1 0.206 R1921 G1 205 N 6 90662895 S954P A G missense Het probably benign 0.001 phenotype 07/14/2014
34 213100 UTSW Kalrn 0.923 R1921 G1 225 N 16 34392093 D28E A T missense Het probably benign 0.018 phenotype 07/14/2014
35 213088 UTSW Lrmda 0.000 R1921 G1 225 N 14 22577870 F52L T C missense Het probably damaging 0.999 phenotype 07/14/2014
36 213020 UTSW Lrp2 1.000 R1921 G1 225 N 2 69523287 D543G T C missense Het probably damaging 1.000 phenotype 07/14/2014
37 213076 UTSW Lrrtm3 0.000 R1921 G1 225 N 10 64088378 T337A T C missense Het probably benign 0.366 07/14/2014
38 213096 UTSW Marf1 0.153 R1921 G1 225 N 16 14128601 D1219N C T missense Het possibly damaging 0.628 phenotype 07/14/2014
39 213048 UTSW Mkln1 0.473 R1921 G1 225 N 6 31428178 K118R A G missense Het probably benign 0.218 phenotype 07/14/2014
40 213108 UTSW Nedd4l 0.878 R1921 G1 225 N 18 65167575 T C critical splice donor site 2 bp Het probably null phenotype 07/14/2014
41 213014 UTSW Neu2 0.066 R1921 G1 154 N 1 87597301 E336G A G missense Het probably benign 0.023 phenotype 07/14/2014
42 213015 UTSW Nfasc 1.000 R1921 G1 225 N 1 132610805 F448S A G missense Het probably damaging 1.000 phenotype 07/14/2014
43 213068 UTSW Nlrx1 0.125 R1921 G1 220 N 9 44254134 E822* C A nonsense Het probably null phenotype 07/14/2014
44 213019 UTSW Nr5a1 1.000 R1921 G1 197 N 2 38694096 Y437C T C missense Het probably damaging 1.000 phenotype 07/14/2014
45 213023 UTSW Olfr1224-ps1 0.066 R1921 G1 225 N 2 89156581 V198A A G missense Het probably benign 0.445 0.275 07/14/2014
46 213077 UTSW Olfr1353 0.066 R1921 G1 225 N 10 78970141 L164* T A nonsense Het probably null phenotype 07/14/2014
47 213067 UTSW Olfr885 0.081 R1921 G1 225 N 9 38061685 Y122H T C missense Het probably damaging 0.998 0.431 phenotype 07/14/2014
48 213037 UTSW Phtf1 0.000 R1921 G1 225 N 3 103969122 Q13* C T nonsense Het probably null 07/14/2014
49 213102 UTSW Pnldc1 0.091 R1921 G1 207 N 17 12888928 L525P A G missense Het possibly damaging 0.937 07/14/2014
50 213095 UTSW Ppl 0.000 R1921 G1 217 N 16 5106124 D162V T A missense Het possibly damaging 0.795 phenotype 07/14/2014
51 213097 UTSW Prkdc 0.948 R1921 G1 225 N 16 15714215 S1448T T A missense Het possibly damaging 0.798 phenotype 07/14/2014
52 213090 UTSW Ptgdr 0.000 R1921 G1 225 N 14 44853281 I340T A G missense Het probably benign 0.002 phenotype 07/14/2014
53 213051 UTSW Recql 0.292 R1921 G1 225 N 6 142365589 I458M T C missense Het probably benign 0.411 phenotype 07/14/2014
54 213028 UTSW Rrbp1 0.142 R1921 G1 225 N 2 143988291 V652E A T missense Het probably benign 0.162 0.090 07/14/2014
55 213099 UTSW Rtp1 0.059 R1921 G1 100 N 16 23431410 I175N T A missense Het probably damaging 0.999 phenotype 07/14/2014
56 213054 UTSW Ryr1 1.000 R1921 G1 225 N 7 29054944 M3523T A G missense Het probably damaging 0.996 phenotype 07/14/2014
57 213036 UTSW S100a16 0.140 R1921 G1 193 N 3 90542396 L62P T C missense Het probably damaging 1.000 07/14/2014
58 213042 UTSW Samd11 0.104 R1921 G1 182 N 4 156248709 E364G T C missense Het probably damaging 1.000 07/14/2014
59 213104 UTSW Satb1 1.000 R1921 G1 148 N 17 51742115 G603* C A nonsense Het probably null phenotype 07/14/2014
60 213044 UTSW Shroom3 1.000 R1921 G1 225 N 5 92962365 T A critical splice donor site 2 bp Het probably null phenotype 07/14/2014
61 213061 UTSW Slc25a15 1.000 R1921 G1 225 N 8 22395761 S3P A G missense Het probably benign 0.000 phenotype 07/14/2014
62 213080 UTSW Socs2 0.212 R1921 G1 225 N 10 95413038 L71* A T nonsense Het probably null phenotype 07/14/2014
63 213081 UTSW Sptbn1 1.000 R1921 G1 202 N 11 30104469 E2208G T C missense Het probably damaging 0.981 phenotype 07/14/2014
64 213066 UTSW St14 1.000 R1921 G1 225 N 9 31089870 V855A A G missense Het possibly damaging 0.944 0.152 phenotype 07/14/2014
65 213038 UTSW Susd1 0.091 R1921 G1 225 N 4 59412191 T121S T A missense Het probably benign 0.033 07/14/2014
66 213031 UTSW Svs3b 0.076 R1921 G1 225 N 2 164255928 S158T A T missense Het probably benign 0.003 0.090 07/14/2014
67 213106 UTSW Synpo 0.154 R1921 G1 225 N 18 60603589 M428I C T missense Het probably benign 0.004 0.090 phenotype 07/14/2014
68 213094 UTSW Syt10 0.082 R1921 G1 225 N 15 89790776 D456N C T missense Het probably damaging 1.000 0.201 phenotype 07/14/2014
69 213074 UTSW Taar4 0.114 R1921 G1 225 N 10 23961341 D283G A G missense Het probably damaging 0.997 phenotype 07/14/2014
70 213063 UTSW Tango6 1.000 R1921 G1 225 N 8 106688794 D82E T A missense Het probably benign 0.061 07/14/2014
71 213107 UTSW Tcof1 1.000 R1921 G1 225 N 18 60838855 T127A T C missense Het possibly damaging 0.869 0.081 phenotype 07/14/2014
72 213069 UTSW Tle3 1.000 R1921 G1 225 N 9 61411340 G A critical splice donor site 1 bp Het probably null phenotype 07/14/2014
73 213101 UTSW Tmem45a 0.071 R1921 G1 225 N 16 56822302 F169L A G missense Het probably benign 0.106 07/14/2014
74 213032 UTSW Trp53rkb 0.803 R1921 G1 225 N 2 166795823 V233E T A missense Het probably damaging 1.000 07/14/2014
75 213085 UTSW Ttc7b 0.295 R1921 G1 225 N 12 100415130 C T splice site 5 bp Het probably null 0.976 07/14/2014
76 213058 UTSW Tubgcp3 0.956 R1921 G1 225 N 8 12621932 L770* A T nonsense Het probably null 07/14/2014
77 213110 UTSW Tut1 0.519 R1921 G1 225 N 19 8966102 G851D G A missense Het probably benign 0.000 phenotype 07/14/2014
78 213025 UTSW Ubr1 0.792 R1921 G1 225 N 2 120930968 T576I G A missense Het probably benign 0.112 0.117 phenotype 07/14/2014
79 213053 UTSW Vmn1r125 0.073 R1921 G1 200 N 7 21272605 Y143N T A missense Het probably damaging 0.995 07/14/2014
80 213105 UTSW Vmn2r120 0.099 R1921 G1 225 N 17 57524839 I317F T A missense Het probably benign 0.011 0.090 07/14/2014
81 213103 UTSW Vmn2r95 0.083 R1921 G1 225 N 17 18424313 N70K T A missense Het probably benign 0.114 07/14/2014
82 213064 UTSW Wdr59 1.000 R1921 G1 225 N 8 111486950 L311* A T nonsense Het probably null 07/14/2014
83 213047 UTSW Wnt2 0.456 R1921 G1 225 N 6 18030253 L12P A G missense Het unknown phenotype 07/14/2014
84 213072 UTSW Xrn1 0.918 R1921 G1 225 N 9 95999497 I700T T C missense Het probably benign 0.044 phenotype 07/14/2014
85 213098 UTSW Ypel1 0.000 R1921 G1 225 N 16 17082579 H98R A G missense Het probably benign 0.004 phenotype 07/14/2014
86 213091 UTSW Zfp219 0.000 R1921 G1 225 N 14 52008234 T434A T C missense Het probably benign 0.001 07/14/2014
87 213052 UTSW Zik1 0.060 R1921 G1 225 N 7 10490016 C385G A C missense Het probably damaging 1.000 07/14/2014
[records 1 to 87 of 87]