Incidental Mutations

104 incidental mutations are currently displayed, and affect 102 genes.
10 are Possibly Damaging.
46 are Probably Damaging.
33 are Probably Benign.
11 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 104] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 215137 UTSW Adcy10 0.267 R1929 G1 225 Y 1 165510297 E160V A T missense Het probably damaging 0.998 0.378 phenotype 07/14/2014
2 266011 UTSW Amdhd2 0.617 R1929 G1 186 N 17 24157886 T C unclassified 456 bp Het probably null 02/05/2015
3 215210 UTSW Angel1 0.237 R1929 G1 225 Y 12 86702319 L656V A C missense Het probably damaging 1.000 0.647 07/14/2014
4 215226 UTSW Ankrd12 0.177 R1929 G1 225 Y 17 65986686 S584L G A missense Het possibly damaging 0.549 0.171 phenotype 07/14/2014
5 215159 UTSW Apbb2 0.000 R1929 G1 225 Y 5 66307615 N679Y T A missense Het probably benign 0.329 0.122 phenotype 07/14/2014
6 215150 UTSW Arid3c 0.341 R1929 G1 225 Y 4 41724744 I364F T A missense Het probably damaging 0.999 0.442 phenotype 07/14/2014
7 215144 UTSW Bcan 0.000 R1929 G1 221 Y 3 87993094 S611C T A missense Het probably damaging 0.997 0.085 phenotype 07/14/2014
8 266010 UTSW Bnip3 0.446 R1929 G1 225 N 7 138894630 T G synonymous Het silent phenotype 02/05/2015
9 215160 UTSW Btc 0.000 R1929 G1 225 Y 5 91362401 Y111C T C missense Het probably damaging 1.000 0.538 phenotype 07/14/2014
10 215232 UTSW Carnmt1 0.959 R1929 G1 225 Y 19 18703370 L336P T C missense Het probably damaging 1.000 0.971 phenotype 07/14/2014
11 215174 UTSW Ccdc83 0.000 R1929 G1 225 Y 7 90224077 V357I C T missense Het probably damaging 0.996 0.093 07/14/2014
12 215177 UTSW Cd2bp2 0.936 R1929 G1 225 Y 7 127193878 D324G T C missense Het probably benign 0.221 0.271 phenotype 07/14/2014
13 215213 UTSW Cdc20b 0.072 R1929 G1 225 Y 13 113071917 T216A A G missense Het probably benign 0.073 0.090 07/14/2014
14 215194 UTSW Cdk17 0.309 R1929 G1 225 Y 10 93228678 Y270H T C missense Het probably damaging 1.000 0.790 phenotype 07/14/2014
15 215202 UTSW Cenpv 0.163 R1929 G1 225 Y 11 62525233 E230G T C missense Het probably benign 0.193 0.155 07/14/2014
16 215192 UTSW Chst11 1.000 R1929 G1 225 Y 10 83191170 Y144H T C missense Het probably damaging 0.994 0.286 phenotype 07/14/2014
17 215168 UTSW Cracr2a 0.000 R1929 G1 186 Y 6 127607298 F107I T A missense Het probably damaging 1.000 0.476 07/14/2014
18 215172 UTSW Cyfip1 1.000 R1929 G1 225 Y 7 55899957 R624L G T missense Het probably null 1.000 0.975 phenotype 07/14/2014
19 215196 UTSW Cyp27b1 0.000 R1929 G1 225 Y 10 127048312 V11D T A missense Het probably damaging 1.000 0.647 phenotype 07/14/2014
20 215199 UTSW Ddc 1.000 R1929 G1 225 Y 11 11835764 N308D T C missense Het probably damaging 0.998 0.718 phenotype 07/14/2014
21 215131 UTSW Des 0.552 R1929 G1 194 Y 1 75363493 M348R T G missense Het probably damaging 0.992 0.873 phenotype 07/14/2014
22 215183 UTSW Dis3l 0.182 R1929 G1 225 Y 9 64330883 D109V T A missense Het probably damaging 0.959 0.691 phenotype 07/14/2014
23 215176 UTSW Dnah3 0.100 R1929 G1 225 Y 7 119975129 I2136F T A missense Het probably benign 0.096 0.130 phenotype 07/14/2014
24 215204 UTSW Dnah9 0.373 R1929 G1 225 Y 11 65976398 S2785G T C missense Het probably benign 0.049 0.090 phenotype 07/14/2014
25 215185 UTSW Dopey1 0.151 R1929 G1 225 N 9 86494418 V235G T G missense Het probably damaging 1.000 07/14/2014
26 215222 UTSW Dtx3l 0.331 R1929 G1 225 Y 16 35933689 D182E A T missense Het possibly damaging 0.951 0.079 phenotype 07/14/2014
27 215218 UTSW Efcab6 0.000 R1929 G1 225 Y 15 83892962 A G splice site Het probably benign 0.090 phenotype 07/14/2014
28 215203 UTSW Elac2 1.000 R1929 G1 189 Y 11 64979189 S27T T A missense Het probably benign 0.005 0.090 phenotype 07/14/2014
29 215175 UTSW Emsy 0.387 R1929 G1 225 Y 7 98626623 K352N T G missense Het probably damaging 0.986 0.079 07/14/2014
30 215130 UTSW Erbb4 1.000 R1929 G1 225 Y 1 68198888 N814S T C missense Het probably damaging 0.975 0.093 phenotype 07/14/2014
31 215169 UTSW Fam71e2 0.082 R1929 G1 225 Y 7 4758187 T509S T A missense Het probably benign 0.002 0.090 07/14/2014
32 215195 UTSW Fgd6 0.523 R1929 G1 225 Y 10 94045006 V574A T C missense Het probably benign 0.012 0.090 07/14/2014
33 215184 UTSW Filip1 0.297 R1929 G1 225 Y 9 79819930 E469G T C missense Het probably damaging 1.000 0.270 phenotype 07/14/2014
34 215136 UTSW Fmo1 0.109 R1929 G1 225 Y 1 162833855 D286E A T missense Het probably damaging 1.000 0.381 phenotype 07/14/2014
35 215135 UTSW Fmo4 0.156 R1929 G1 225 Y 1 162799047 I310N A T missense Het possibly damaging 0.952 0.179 phenotype 07/14/2014
36 215153 UTSW Focad 0.542 R1929 G1 225 Y 4 88342212 N902D A G missense Het unknown 0.060 07/14/2014
37 215154 UTSW Focad 0.542 R1929 G1 225 Y 4 88397179 S1525G A G missense Het probably benign 0.317 0.072 07/14/2014
38 215161 UTSW Fras1 0.000 R1929 G1 225 Y 5 96667437 W1338R T C missense Het probably benign 0.242 0.749 phenotype 07/14/2014
39 215165 UTSW Fry 0.526 R1929 G1 225 Y 5 150400924 I1151V A G missense Het probably null 0.019 0.147 07/14/2014
40 215217 UTSW Gm10076 0.377 R1929 G1 136 Y 14 105681870 T G exon Het noncoding transcript 0.087 07/14/2014
41 215155 UTSW Gm13088 0.058 R1929 G1 225 Y 4 143654142 T437I G A missense Het probably damaging 0.999 0.647 07/14/2014
42 215126 UTSW Gm5698 0.126 R1929 G1 225 Y 1 30977961 D3A T G missense Het probably damaging 0.971 0.168 07/14/2014
43 215193 UTSW Gm8394 0.824 R1929 G1 225 Y 10 85313731 A G exon Het noncoding transcript 0.153 07/14/2014
44 215207 UTSW Gngt2 0.069 R1929 G1 225 Y 11 95845146 C T splice site Het probably benign 0.090 phenotype 07/14/2014
45 215208 UTSW Gsdma 0.058 R1929 G1 225 Y 11 98671367 T C critical splice donor site 2 bp Het probably null 0.950 07/14/2014
46 215164 UTSW Gtf2h3 0.954 R1929 G1 225 Y 5 124602199 A T unclassified Het probably benign 0.096 phenotype 07/14/2014
47 215189 UTSW Hkdc1 0.129 R1929 G1 172 Y 10 62417898 T35A T C missense Het probably benign 0.012 0.125 phenotype 07/14/2014
48 215132 UTSW Irs1 0.616 R1929 G1 225 Y 1 82288459 S679G T C missense Het probably benign 0.000 0.060 phenotype 07/14/2014
49 215167 UTSW Itpr1 0.797 R1929 G1 225 Y 6 108493755 C2214S T A missense Het probably damaging 0.999 0.952 phenotype 07/14/2014
50 215225 UTSW Kcnh8 0.000 R1929 G1 122 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 07/14/2014
51 215215 UTSW Kcnk16 0.075 R1929 G1 216 Y 14 20265279 V72A A G missense Het probably damaging 0.989 0.081 phenotype 07/14/2014
52 215233 UTSW Lipa 0.000 R1929 G1 225 Y 19 34510890 R119* T A nonsense Het probably null 0.976 phenotype 07/14/2014
53 215227 UTSW Matr3 0.962 R1929 G1 225 Y 18 35588325 T A splice site Het probably benign phenotype 07/14/2014
54 215163 UTSW Med13l 0.959 R1929 G1 225 Y 5 118728833 F651V T G missense Het probably benign 0.011 0.090 phenotype 07/14/2014
55 215209 UTSW Mfsd11 0.142 R1929 G1 225 Y 11 116873914 V388A T C missense Het probably benign 0.001 0.165 07/14/2014
56 215179 UTSW Mki67 0.812 R1929 G1 225 Y 7 135698065 V1747I C T missense Het possibly damaging 0.456 0.179 phenotype 07/14/2014
57 215148 UTSW Mms22l 1.000 R1929 G1 225 Y 4 24535936 T C unclassified Het probably benign 0.090 phenotype 07/14/2014
58 215224 UTSW Msh5 0.000 R1929 G1 225 Y 17 35044390 I154T A G missense Het probably benign 0.241 0.109 phenotype 07/14/2014
59 215230 UTSW Myo5b 0.738 R1929 G1 225 Y 18 74733925 L1382F G T missense Het probably damaging 0.993 0.647 phenotype 07/14/2014
60 215221 UTSW Ncbp2 1.000 R1929 G1 225 Y 16 31956951 Y138H T C missense Het probably damaging 0.988 0.174 phenotype 07/14/2014
61 215231 UTSW Ndufv1 1.000 R1929 G1 225 Y 19 4008347 R359L C A missense Het probably benign 0.112 0.262 phenotype 07/14/2014
62 215173 UTSW Ntrk3 1.000 R1929 G1 225 Y 7 78516723 A C splice site 6 bp Het probably null 0.976 phenotype 07/14/2014
63 215140 UTSW Olfr1234 0.102 R1929 G1 225 Y 2 89363009 V140A A G missense Het probably benign 0.006 0.090 phenotype 07/14/2014
64 215205 UTSW Olfr376 0.000 R1929 G1 225 Y 11 73375601 V287E T A missense Het probably damaging 0.999 0.492 phenotype 07/14/2014
65 215182 UTSW Olfr870 0.060 R1929 G1 225 Y 9 20171409 H54L T A missense Het possibly damaging 0.728 0.179 phenotype 07/14/2014
66 215188 UTSW P4ha1 1.000 R1929 G1 225 Y 10 59371037 E523G A G missense Het probably damaging 1.000 0.266 phenotype 07/14/2014
67 215156 UTSW Per3 0.112 R1929 G1 218 Y 4 151018885 Y530F T A missense Het probably damaging 1.000 0.405 phenotype 07/14/2014
68 215197 UTSW Pes1 1.000 R1929 G1 225 Y 11 3969524 L66I C A missense Het probably damaging 1.000 0.071 phenotype 07/14/2014
69 215134 UTSW Pigr 0.063 R1929 G1 188 Y 1 130846662 G A unclassified Het probably benign 0.090 phenotype 07/14/2014
70 215198 UTSW Pkd1l1 1.000 R1929 G1 225 Y 11 8836197 A T splice site Het probably benign phenotype 07/14/2014
71 215143 UTSW Plch1 0.257 R1929 G1 225 Y 3 63744535 K378N T A missense Het probably damaging 1.000 0.508 phenotype 07/14/2014
72 215186 UTSW Plxnb1 0.000 R1929 G1 225 Y 9 109102708 T C splice site 6 bp Het probably null 0.976 phenotype 07/14/2014
73 215220 UTSW Prkdc 0.954 R1929 G1 225 Y 16 15654817 A G splice site Het probably null 0.976 phenotype 07/14/2014
74 215228 UTSW Prrc1 0.120 R1929 G1 225 Y 18 57381646 D312Y G T missense Het probably damaging 0.982 0.497 07/14/2014
75 215138 UTSW Rab3gap2 0.000 R1929 G1 124 Y 1 185283542 T A critical splice donor site 2 bp Het probably null 0.958 phenotype 07/14/2014
76 215151 UTSW Rgs3 0.143 R1929 G1 123 Y 4 62702147 I537V A G missense Het probably damaging 0.998 0.276 phenotype 07/14/2014
77 215216 UTSW Rhobtb2 0.000 R1929 G1 225 Y 14 69796444 D444A T G missense Het probably damaging 0.988 0.315 phenotype 07/14/2014
78 215178 UTSW Rnf40 0.962 R1929 G1 225 Y 7 127591784 S314P T C missense Het probably damaging 0.994 0.076 phenotype 07/14/2014
79 215149 UTSW Rngtt 0.967 R1929 G1 225 Y 4 33500302 C565* T A nonsense Het probably null 0.976 07/14/2014
80 215187 UTSW Samd3 0.127 R1929 G1 223 Y 10 26263986 A G splice site Het probably benign 0.090 07/14/2014
81 215139 UTSW Sec61a2 0.222 R1929 G1 225 Y 2 5873736 A G splice site Het probably benign phenotype 07/14/2014
82 215211 UTSW Serpina3m 0.071 R1929 G1 225 Y 12 104389322 A83T G A missense Het probably damaging 0.969 0.389 07/14/2014
83 215133 UTSW Serpinb13 0.079 R1929 G1 225 Y 1 106999026 I251L A T missense Het possibly damaging 0.847 0.179 phenotype 07/14/2014
84 215206 UTSW Sez6 0.000 R1929 G1 225 Y 11 77972932 T439I C T missense Het probably damaging 1.000 0.208 phenotype 07/14/2014
85 215145 UTSW Shc1 0.963 R1929 G1 225 Y 3 89423542 G91S G A missense Het probably damaging 1.000 0.705 phenotype 07/14/2014
86 215229 UTSW Slc26a2 0.318 R1929 G1 225 Y 18 61198578 C594R A G missense Het possibly damaging 0.685 0.191 phenotype 07/14/2014
87 215190 UTSW Specc1l 0.605 R1929 G1 225 Y 10 75245604 S278F C T missense Het probably damaging 1.000 0.435 phenotype 07/14/2014
88 215141 UTSW Spg11 0.211 R1929 G1 225 Y 2 122060207 V2044M C T missense Het probably damaging 0.998 0.160 phenotype 07/14/2014
89 215158 UTSW Stx18 1.000 R1929 G1 225 Y 5 38128039 T A splice site Het probably null 0.976 phenotype 07/14/2014
90 215166 UTSW Suclg2 0.000 R1929 G1 225 Y 6 95589094 T C splice site Het probably benign 0.090 phenotype 07/14/2014
91 215152 UTSW Tlr4 0.000 R1929 G1 225 Y 4 66839444 H158L A T missense Het probably damaging 0.998 0.156 phenotype 07/14/2014
92 215129 UTSW Tmem131 0.749 R1929 G1 225 Y 1 36812271 V966A A G missense Het possibly damaging 0.504 0.124 07/14/2014
93 215146 UTSW Tram1l1 0.121 R1929 G1 225 Y 3 124321986 I265N T A missense Het probably damaging 0.999 0.387 07/14/2014
94 215200 UTSW Trim58 0.058 R1929 G1 88 Y 11 58640667 F67Y T A missense Het possibly damaging 0.844 0.165 07/14/2014
95 215201 UTSW Ttc19 0.230 R1929 G1 111 Y 11 62281824 Q74R A G missense Het probably benign 0.210 0.081 phenotype 07/14/2014
96 215219 UTSW Usp7 1.000 R1929 G1 225 Y 16 8698469 S649G T C missense Het probably benign 0.001 0.101 phenotype 07/14/2014
97 215162 UTSW Vmn2r16 0.173 R1929 G1 225 Y 5 109339258 Y115C A G missense Het possibly damaging 0.924 0.179 07/14/2014
98 215170 UTSW Zfp444 0.174 R1929 G1 127 Y 7 6189555 C191R T C missense Het probably damaging 0.994 0.446 phenotype 07/14/2014
99 215127 UTSW Zfp451 0.000 R1929 G1 225 Y 1 33782193 F151L A G missense Het probably damaging 0.999 0.648 07/14/2014
100 215128 UTSW Zfp451 0.000 R1929 G1 225 Y 1 33783856 P99S G A missense Het probably benign 0.124 0.198 07/14/2014
[records 1 to 100 of 104] next >> last >|