Incidental Mutations

104 incidental mutations are currently displayed, and affect 102 genes.
10 are Possibly Damaging.
46 are Probably Damaging.
33 are Probably Benign.
11 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 104] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 215137 UTSW Adcy10 0.322 R1929 G1 225 Y 1 165510297 E160V A T missense Het probably damaging 0.998 0.378 phenotype 07/14/2014
2 266011 UTSW Amdhd2 0.528 R1929 G1 186 N 17 24157886 T C splice site 456 bp Het probably null 02/05/2015
3 215210 UTSW Angel1 0.156 R1929 G1 225 Y 12 86702319 L656V A C missense Het probably damaging 1.000 0.647 07/14/2014
4 215226 UTSW Ankrd12 0.220 R1929 G1 225 Y 17 65986686 S584L G A missense Het possibly damaging 0.549 0.171 phenotype 07/14/2014
5 215159 UTSW Apbb2 0.000 R1929 G1 225 Y 5 66307615 N679Y T A missense Het probably benign 0.329 0.122 phenotype 07/14/2014
6 215150 UTSW Arid3c 0.238 R1929 G1 225 Y 4 41724744 I364F T A missense Het probably damaging 0.999 0.442 phenotype 07/14/2014
7 215144 UTSW Bcan 0.000 R1929 G1 221 Y 3 87993094 S611C T A missense Het probably damaging 0.997 0.085 phenotype 07/14/2014
8 266010 UTSW Bnip3 0.675 R1929 G1 225 N 7 138894630 T G synonymous Het silent phenotype 02/05/2015
9 215160 UTSW Btc 0.000 R1929 G1 225 Y 5 91362401 Y111C T C missense Het probably damaging 1.000 0.538 phenotype 07/14/2014
10 215232 UTSW Carnmt1 0.958 R1929 G1 225 Y 19 18703370 L336P T C missense Het probably damaging 1.000 0.971 phenotype 07/14/2014
11 215174 UTSW Ccdc83 0.000 R1929 G1 225 Y 7 90224077 V357I C T missense Het probably damaging 0.996 0.093 07/14/2014
12 215177 UTSW Cd2bp2 0.917 R1929 G1 225 Y 7 127193878 D324G T C missense Het probably benign 0.221 0.271 phenotype 07/14/2014
13 215213 UTSW Cdc20b 0.069 R1929 G1 225 Y 13 113071917 T216A A G missense Het probably benign 0.073 0.090 07/14/2014
14 215194 UTSW Cdk17 0.337 R1929 G1 225 Y 10 93228678 Y270H T C missense Het probably damaging 1.000 0.790 phenotype 07/14/2014
15 215202 UTSW Cenpv 0.154 R1929 G1 225 Y 11 62525233 E230G T C missense Het probably benign 0.193 0.155 07/14/2014
16 215192 UTSW Chst11 1.000 R1929 G1 225 Y 10 83191170 Y144H T C missense Het probably damaging 0.994 0.286 phenotype 07/14/2014
17 215168 UTSW Cracr2a 0.000 R1929 G1 186 Y 6 127607298 F107I T A missense Het probably damaging 1.000 0.476 07/14/2014
18 215172 UTSW Cyfip1 1.000 R1929 G1 225 Y 7 55899957 R624L G T missense Het probably null 1.000 0.975 phenotype 07/14/2014
19 215196 UTSW Cyp27b1 0.000 R1929 G1 225 Y 10 127048312 V11D T A missense Het probably damaging 1.000 0.647 phenotype 07/14/2014
20 215199 UTSW Ddc 1.000 R1929 G1 225 Y 11 11835764 N308D T C missense Het probably damaging 0.998 0.718 phenotype 07/14/2014
21 215131 UTSW Des 0.521 R1929 G1 194 Y 1 75363493 M348R T G missense Het probably damaging 0.992 0.873 phenotype 07/14/2014
22 215183 UTSW Dis3l 0.226 R1929 G1 225 Y 9 64330883 D109V T A missense Het probably damaging 0.959 0.691 phenotype 07/14/2014
23 215176 UTSW Dnah3 0.106 R1929 G1 225 Y 7 119975129 I2136F T A missense Het probably benign 0.096 0.130 phenotype 07/14/2014
24 215204 UTSW Dnah9 0.411 R1929 G1 225 Y 11 65976398 S2785G T C missense Het probably benign 0.049 0.090 phenotype 07/14/2014
25 215185 UTSW Dopey1 0.305 R1929 G1 225 N 9 86494418 V235G T G missense Het probably damaging 1.000 07/14/2014
26 215222 UTSW Dtx3l 0.362 R1929 G1 225 Y 16 35933689 D182E A T missense Het possibly damaging 0.951 0.079 phenotype 07/14/2014
27 215218 UTSW Efcab6 0.000 R1929 G1 225 Y 15 83892962 A G splice site Het probably benign 0.090 phenotype 07/14/2014
28 215203 UTSW Elac2 1.000 R1929 G1 189 Y 11 64979189 S27T T A missense Het probably benign 0.005 0.090 phenotype 07/14/2014
29 215175 UTSW Emsy 0.466 R1929 G1 225 Y 7 98626623 K352N T G missense Het probably damaging 0.986 0.079 07/14/2014
30 215130 UTSW Erbb4 1.000 R1929 G1 225 Y 1 68198888 N814S T C missense Het probably damaging 0.975 0.093 phenotype 07/14/2014
31 215169 UTSW Fam71e2 0.077 R1929 G1 225 Y 7 4758187 T509S T A missense Het probably benign 0.002 0.090 07/14/2014
32 215195 UTSW Fgd6 0.470 R1929 G1 225 Y 10 94045006 V574A T C missense Het probably benign 0.012 0.090 07/14/2014
33 215184 UTSW Filip1 0.310 R1929 G1 225 Y 9 79819930 E469G T C missense Het probably damaging 1.000 0.270 phenotype 07/14/2014
34 215136 UTSW Fmo1 0.072 R1929 G1 225 Y 1 162833855 D286E A T missense Het probably damaging 1.000 0.381 phenotype 07/14/2014
35 215135 UTSW Fmo4 0.120 R1929 G1 225 Y 1 162799047 I310N A T missense Het possibly damaging 0.952 0.179 phenotype 07/14/2014
36 215153 UTSW Focad 0.608 R1929 G1 225 Y 4 88342212 N902D A G missense Het unknown 0.060 07/14/2014
37 215154 UTSW Focad 0.608 R1929 G1 225 Y 4 88397179 S1525G A G missense Het probably benign 0.317 0.072 07/14/2014
38 215161 UTSW Fras1 0.000 R1929 G1 225 Y 5 96667437 W1338R T C missense Het probably benign 0.242 0.749 phenotype 07/14/2014
39 215165 UTSW Fry 0.602 R1929 G1 225 Y 5 150400924 I1151V A G missense Het probably null 0.019 0.147 07/14/2014
40 215217 UTSW Gm10076 0.377 R1929 G1 136 Y 14 105681870 T G exon Het noncoding transcript 0.087 07/14/2014
41 215155 UTSW Gm13088 0.051 R1929 G1 225 Y 4 143654142 T437I G A missense Het probably damaging 0.999 0.647 07/14/2014
42 215126 UTSW Gm5698 0.126 R1929 G1 225 Y 1 30977961 D3A T G missense Het probably damaging 0.971 0.168 07/14/2014
43 215193 UTSW Gm8394 0.858 R1929 G1 225 Y 10 85313731 A G exon Het noncoding transcript 0.153 07/14/2014
44 215207 UTSW Gngt2 0.069 R1929 G1 225 Y 11 95845146 C T splice site Het probably benign 0.090 phenotype 07/14/2014
45 215208 UTSW Gsdma 0.052 R1929 G1 225 Y 11 98671367 T C critical splice donor site 2 bp Het probably null 0.950 07/14/2014
46 215164 UTSW Gtf2h3 0.956 R1929 G1 225 Y 5 124602199 A T unclassified Het probably benign 0.096 phenotype 07/14/2014
47 215189 UTSW Hkdc1 0.125 R1929 G1 172 Y 10 62417898 T35A T C missense Het probably benign 0.012 0.125 phenotype 07/14/2014
48 215132 UTSW Irs1 0.639 R1929 G1 225 Y 1 82288459 S679G T C missense Het probably benign 0.000 0.060 phenotype 07/14/2014
49 215167 UTSW Itpr1 0.743 R1929 G1 225 Y 6 108493755 C2214S T A missense Het probably damaging 0.999 0.952 phenotype 07/14/2014
50 215225 UTSW Kcnh8 0.000 R1929 G1 122 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 07/14/2014
51 215215 UTSW Kcnk16 0.095 R1929 G1 216 Y 14 20265279 V72A A G missense Het probably damaging 0.989 0.081 phenotype 07/14/2014
52 215233 UTSW Lipa 0.000 R1929 G1 225 Y 19 34510890 R119* T A nonsense Het probably null 0.976 phenotype 07/14/2014
53 215227 UTSW Matr3 0.959 R1929 G1 225 Y 18 35588325 T A splice site Het probably benign phenotype 07/14/2014
54 215163 UTSW Med13l 0.966 R1929 G1 225 Y 5 118728833 F651V T G missense Het probably benign 0.011 0.090 phenotype 07/14/2014
55 215209 UTSW Mfsd11 0.138 R1929 G1 225 Y 11 116873914 V388A T C missense Het probably benign 0.001 0.165 07/14/2014
56 215179 UTSW Mki67 0.807 R1929 G1 225 Y 7 135698065 V1747I C T missense Het possibly damaging 0.456 0.179 phenotype 07/14/2014
57 215148 UTSW Mms22l 1.000 R1929 G1 225 Y 4 24535936 T C unclassified Het probably benign 0.090 phenotype 07/14/2014
58 215224 UTSW Msh5 0.000 R1929 G1 225 Y 17 35044390 I154T A G missense Het probably benign 0.241 0.109 phenotype 07/14/2014
59 215230 UTSW Myo5b 0.804 R1929 G1 225 Y 18 74733925 L1382F G T missense Het probably damaging 0.993 0.647 phenotype 07/14/2014
60 215221 UTSW Ncbp2 1.000 R1929 G1 225 Y 16 31956951 Y138H T C missense Het probably damaging 0.988 0.174 phenotype 07/14/2014
61 215231 UTSW Ndufv1 1.000 R1929 G1 225 Y 19 4008347 R359L C A missense Het probably benign 0.112 0.262 phenotype 07/14/2014
62 215173 UTSW Ntrk3 1.000 R1929 G1 225 Y 7 78516723 A C splice site 6 bp Het probably null 0.976 phenotype 07/14/2014
63 215140 UTSW Olfr1234 0.129 R1929 G1 225 Y 2 89363009 V140A A G missense Het probably benign 0.006 0.090 phenotype 07/14/2014
64 215205 UTSW Olfr376 0.000 R1929 G1 225 Y 11 73375601 V287E T A missense Het probably damaging 0.999 0.492 phenotype 07/14/2014
65 215182 UTSW Olfr870 0.057 R1929 G1 225 Y 9 20171409 H54L T A missense Het possibly damaging 0.728 0.179 phenotype 07/14/2014
66 215188 UTSW P4ha1 1.000 R1929 G1 225 Y 10 59371037 E523G A G missense Het probably damaging 1.000 0.266 phenotype 07/14/2014
67 215156 UTSW Per3 0.143 R1929 G1 218 Y 4 151018885 Y530F T A missense Het probably damaging 1.000 0.405 phenotype 07/14/2014
68 215197 UTSW Pes1 1.000 R1929 G1 225 Y 11 3969524 L66I C A missense Het probably damaging 1.000 0.071 phenotype 07/14/2014
69 215134 UTSW Pigr 0.058 R1929 G1 188 Y 1 130846662 G A unclassified Het probably benign 0.090 phenotype 07/14/2014
70 215198 UTSW Pkd1l1 1.000 R1929 G1 225 Y 11 8836197 A T splice site Het probably benign phenotype 07/14/2014
71 215143 UTSW Plch1 0.167 R1929 G1 225 Y 3 63744535 K378N T A missense Het probably damaging 1.000 0.508 phenotype 07/14/2014
72 215186 UTSW Plxnb1 0.000 R1929 G1 225 Y 9 109102708 T C splice site 6 bp Het probably null 0.976 phenotype 07/14/2014
73 215220 UTSW Prkdc 0.957 R1929 G1 225 Y 16 15654817 A G splice site Het probably null 0.976 phenotype 07/14/2014
74 215228 UTSW Prrc1 0.115 R1929 G1 225 Y 18 57381646 D312Y G T missense Het probably damaging 0.982 0.497 07/14/2014
75 215138 UTSW Rab3gap2 0.000 R1929 G1 124 Y 1 185283542 T A critical splice donor site 2 bp Het probably null 0.958 phenotype 07/14/2014
76 215151 UTSW Rgs3 0.123 R1929 G1 123 Y 4 62702147 I537V A G missense Het probably damaging 0.998 0.276 phenotype 07/14/2014
77 215216 UTSW Rhobtb2 0.000 R1929 G1 225 Y 14 69796444 D444A T G missense Het probably damaging 0.988 0.315 phenotype 07/14/2014
78 215178 UTSW Rnf40 0.966 R1929 G1 225 Y 7 127591784 S314P T C missense Het probably damaging 0.994 0.076 phenotype 07/14/2014
79 215149 UTSW Rngtt 0.969 R1929 G1 225 Y 4 33500302 C565* T A nonsense Het probably null 0.976 07/14/2014
80 215187 UTSW Samd3 0.134 R1929 G1 223 Y 10 26263986 A G splice site Het probably benign 0.090 07/14/2014
81 215139 UTSW Sec61a2 0.208 R1929 G1 225 Y 2 5873736 A G splice site Het probably benign phenotype 07/14/2014
82 215211 UTSW Serpina3m 0.064 R1929 G1 225 Y 12 104389322 A83T G A missense Het probably damaging 0.969 0.389 07/14/2014
83 215133 UTSW Serpinb13 0.075 R1929 G1 225 Y 1 106999026 I251L A T missense Het possibly damaging 0.847 0.179 phenotype 07/14/2014
84 215206 UTSW Sez6 0.000 R1929 G1 225 Y 11 77972932 T439I C T missense Het probably damaging 1.000 0.208 phenotype 07/14/2014
85 215145 UTSW Shc1 0.970 R1929 G1 225 Y 3 89423542 G91S G A missense Het probably damaging 1.000 0.705 phenotype 07/14/2014
86 215229 UTSW Slc26a2 0.297 R1929 G1 225 Y 18 61198578 C594R A G missense Het possibly damaging 0.685 0.191 phenotype 07/14/2014
87 215190 UTSW Specc1l 0.561 R1929 G1 225 Y 10 75245604 S278F C T missense Het probably damaging 1.000 0.435 phenotype 07/14/2014
88 215141 UTSW Spg11 0.179 R1929 G1 225 Y 2 122060207 V2044M C T missense Het probably damaging 0.998 0.160 phenotype 07/14/2014
89 215158 UTSW Stx18 1.000 R1929 G1 225 Y 5 38128039 T A splice site Het probably null 0.976 phenotype 07/14/2014
90 215166 UTSW Suclg2 0.000 R1929 G1 225 Y 6 95589094 T C splice site Het probably benign 0.090 phenotype 07/14/2014
91 215152 UTSW Tlr4 0.000 R1929 G1 225 Y 4 66839444 H158L A T missense Het probably damaging 0.998 0.156 phenotype 07/14/2014
92 215129 UTSW Tmem131 0.891 R1929 G1 225 Y 1 36812271 V966A A G missense Het possibly damaging 0.504 0.124 07/14/2014
93 215146 UTSW Tram1l1 0.145 R1929 G1 225 Y 3 124321986 I265N T A missense Het probably damaging 0.999 0.387 07/14/2014
94 215200 UTSW Trim58 0.056 R1929 G1 88 Y 11 58640667 F67Y T A missense Het possibly damaging 0.844 0.165 07/14/2014
95 215201 UTSW Ttc19 0.205 R1929 G1 111 Y 11 62281824 Q74R A G missense Het probably benign 0.210 0.081 phenotype 07/14/2014
96 215219 UTSW Usp7 1.000 R1929 G1 225 Y 16 8698469 S649G T C missense Het probably benign 0.001 0.101 phenotype 07/14/2014
97 215162 UTSW Vmn2r16 0.152 R1929 G1 225 Y 5 109339258 Y115C A G missense Het possibly damaging 0.924 0.179 07/14/2014
98 215170 UTSW Zfp444 0.135 R1929 G1 127 Y 7 6189555 C191R T C missense Het probably damaging 0.994 0.446 phenotype 07/14/2014
99 215127 UTSW Zfp451 0.000 R1929 G1 225 Y 1 33782193 F151L A G missense Het probably damaging 0.999 0.648 07/14/2014
100 215128 UTSW Zfp451 0.000 R1929 G1 225 Y 1 33783856 P99S G A missense Het probably benign 0.124 0.198 07/14/2014
[records 1 to 100 of 104] next >> last >|