Incidental Mutations

53 incidental mutations are currently displayed, and affect 53 genes.
5 are Possibly Damaging.
24 are Probably Damaging.
17 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 53 of 53] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 236795 UTSW 2410089E03Rik 1.000 R2208 G1 225 Y 15 8194403 N883K T A missense Het probably benign 0.331 0.061 phenotype 10/02/2014
2 236804 UTSW Ahnak 0.244 R2208 G1 225 Y 19 9017732 V5460A T C missense Het probably benign 0.002 0.090 phenotype 10/02/2014
3 236782 UTSW Bco2 0.063 R2208 G1 191 Y 9 50533455 V517A A G missense Het probably damaging 1.000 0.508 phenotype 10/02/2014
4 236773 UTSW Brca2 1.000 R2208 G1 225 Y 5 150532344 D183E T A missense Het probably damaging 0.964 0.090 phenotype 10/02/2014
5 236774 UTSW Ccdc142 0.166 R2208 G1 225 Y 6 83107960 T C splice site 6 bp Het probably null 0.976 10/02/2014
6 236764 UTSW Ccdc39 0.414 R2208 G1 225 Y 3 33841178 L34P A G missense Het probably damaging 0.990 0.083 phenotype 10/02/2014
7 236791 UTSW Cdc42bpb 0.753 R2208 G1 225 Y 12 111336029 H198L T A missense Het probably damaging 1.000 0.973 phenotype 10/02/2014
8 236758 UTSW Cdc73 1.000 R2208 G1 225 Y 1 143609382 E516V T A missense Het probably damaging 0.998 0.646 phenotype 10/02/2014
9 236792 UTSW Cep170b 0.654 R2208 G1 225 Y 12 112738985 L1059Q T A missense Het probably benign 0.003 0.090 10/02/2014
10 236803 UTSW Chrm1 0.118 R2208 G1 225 Y 19 8678099 L56P T C missense Het probably damaging 1.000 0.956 phenotype 10/02/2014
11 236777 UTSW Clec4d 0.000 R2208 G1 225 Y 6 123265355 V22D T A missense Het probably damaging 0.981 0.205 phenotype 10/02/2014
12 236806 UTSW Cyp2c39 0.089 R2208 G1 225 Y 19 39560961 Y308H T C missense Het possibly damaging 0.556 0.386 10/02/2014
13 236798 UTSW Cyp2d12 0.165 R2208 G1 225 Y 15 82556936 L141P T C missense Het probably damaging 1.000 0.647 10/02/2014
14 236767 UTSW Cyp4x1 0.190 R2208 G1 225 Y 4 115126594 Q85K G T missense Het probably benign 0.009 0.064 phenotype 10/02/2014
15 236771 UTSW Dpysl5 0.342 R2208 G1 225 Y 5 30791597 D399N G A missense Het probably damaging 1.000 0.939 phenotype 10/02/2014
16 236789 UTSW Enpp7 0.000 R2208 G1 225 Y 11 118988762 T C splice site Het probably benign phenotype 10/02/2014
17 236769 UTSW Fabp3 0.000 R2208 G1 225 Y 4 130312387 T57I C T missense Het probably benign 0.208 0.757 phenotype 10/02/2014
18 236763 UTSW Fitm2 1.000 R2208 G1 225 Y 2 163472684 T A unclassified Het probably benign 0.090 phenotype 10/02/2014
19 236762 UTSW Gm14139 0.087 R2208 G1 225 Y 2 150193145 V462E T A missense Het probably benign 0.396 0.090 10/02/2014
20 318100 UTSW Gng10 0.252 R2208 G1 61 Y 4 59035314 I26N T A missense Het possibly damaging 0.640 0.533 05/28/2015
21 236790 UTSW Gpr33 0.000 R2208 G1 225 Y 12 52023453 V268I C T missense Het probably benign 0.003 0.090 phenotype 10/02/2014
22 236759 UTSW Hmcn2 0.000 R2208 G1 225 Y 2 31380297 C1182Y G A missense Het probably damaging 1.000 0.389 10/02/2014
23 236802 UTSW Kcnh8 0.000 R2208 G1 179 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 10/02/2014
24 236787 UTSW Krt36 0.071 R2208 G1 225 Y 11 100102939 V358M C T missense Het probably damaging 0.960 0.182 phenotype 10/02/2014
25 236775 UTSW Lmod3 0.087 R2208 G1 225 Y 6 97247877 I328V T C missense Het probably benign 0.065 0.097 phenotype 10/02/2014
26 236766 UTSW Lrp8 0.391 R2208 G1 146 Y 4 107855790 V580A T C missense Het probably damaging 0.997 0.460 phenotype 10/02/2014
27 236770 UTSW Masp2 0.151 R2208 G1 225 Y 4 148614415 I651T T C missense Het probably damaging 1.000 0.140 phenotype 10/02/2014
28 236765 UTSW Mnd1 0.000 R2208 G1 225 Y 3 84134109 C62F C A missense Het probably benign 0.297 0.078 phenotype 10/02/2014
29 236786 UTSW Msi2 1.000 R2208 G1 225 Y 11 88590108 S118T A T missense Het probably damaging 0.999 0.301 phenotype 10/02/2014
30 236799 UTSW Muc19 0.267 R2208 G1 225 Y 15 91871549 T C exon Het noncoding transcript 0.087 phenotype 10/02/2014
31 236756 UTSW Nabp1 0.233 R2208 G1 225 Y 1 51477614 R32* G A nonsense Het probably null 0.976 phenotype 10/02/2014
32 236781 UTSW Nfix 0.423 R2208 G1 104 Y 8 84716247 CAAAAA CAAAA frame shift Het probably null 0.976 phenotype 10/02/2014
33 236785 UTSW Nup88 0.968 R2208 G1 225 Y 11 70965719 D196G T C missense Het probably damaging 0.996 0.807 phenotype 10/02/2014
34 236793 UTSW Olfr747 0.118 R2208 G1 225 N 14 50681563 I24V T C missense Het probably benign 0.006 phenotype 10/02/2014
35 236761 UTSW Pax1 0.608 R2208 G1 225 Y 2 147365802 I198N T A missense Het probably damaging 1.000 0.935 phenotype 10/02/2014
36 236779 UTSW Pde3a 0.412 R2208 G1 225 Y 6 141250347 E253G A G missense Het probably damaging 0.974 0.062 phenotype 10/02/2014
37 318101 UTSW Phldb1 0.143 R2208 G1 40 Y 9 44696131 R1192Q C T missense Het probably damaging 0.999 0.647 05/28/2015
38 236778 UTSW Pianp 0.080 R2208 G1 225 Y 6 124999639 P137Q C A missense Het probably damaging 0.998 0.106 phenotype 10/02/2014
39 266090 UTSW Prdm15 0.000 R2208 G1 225 N 16 97799264 A C intron Het probably null 02/05/2015
40 236768 UTSW Ptprf 0.809 R2208 G1 146 Y 4 118269172 A T splice site Het probably benign phenotype 10/02/2014
41 236783 UTSW Rfx7 0.837 R2208 G1 225 Y 9 72617964 D812G A G missense Het probably benign 0.001 0.058 phenotype 10/02/2014
42 236796 UTSW Rgs22 0.000 R2208 G1 225 Y 15 36050232 T691A T C missense Het probably benign 0.006 0.075 10/02/2014
43 236788 UTSW Rundc3a 0.108 R2208 G1 225 Y 11 102402088 S436C A T missense Het probably damaging 1.000 0.197 10/02/2014
44 236797 UTSW Sntb1 0.070 R2208 G1 225 Y 15 55906318 T92A T C missense Het possibly damaging 0.788 0.065 phenotype 10/02/2014
45 236780 UTSW Tarsl2 0.128 R2208 G1 225 Y 7 65682848 S566P T C missense Het probably damaging 1.000 0.902 10/02/2014
46 236784 UTSW Tbc1d32 0.890 R2208 G1 225 Y 10 56150792 A T critical splice donor site 2 bp Het probably null 0.949 phenotype 10/02/2014
47 236794 UTSW Tep1 0.000 R2208 G1 225 Y 14 50866864 Q191R T C missense Het probably benign 0.013 0.090 phenotype 10/02/2014
48 236760 UTSW Tmc2 0.374 R2208 G1 225 Y 2 130214563 C A splice site Het probably null 0.976 phenotype 10/02/2014
49 236757 UTSW Tns1 0.533 R2208 G1 225 Y 1 74079240 I77S A C missense Het probably damaging 0.996 0.209 phenotype 10/02/2014
50 236805 UTSW Trpd52l3 0.095 R2208 G1 225 Y 19 30004246 W134R T C missense Het probably damaging 1.000 0.843 phenotype 10/02/2014
51 236772 UTSW Vmn2r15 0.092 R2208 G1 225 Y 5 109297443 N38K A C missense Het possibly damaging 0.638 0.179 10/02/2014
52 236800 UTSW Wdr90 0.097 R2208 G1 225 Y 17 25860388 D257E A T missense Het probably damaging 1.000 0.647 10/02/2014
53 236801 UTSW Zbtb9 0.208 R2208 G1 225 Y 17 26974124 C168R T C missense Het possibly damaging 0.897 0.061 10/02/2014
[records 1 to 53 of 53]