Incidental Mutations

75 incidental mutations are currently displayed, and affect 75 genes.
20 are Possibly Damaging.
25 are Probably Damaging.
25 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 75 of 75] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 244118 UTSW 4930578C19Rik 0.065 R2265 G1 222 N X 18423687 S179P A G missense Het possibly damaging 0.734 0.239 10/16/2014
2 244035 UTSW A830018L16Rik 0.064 R2265 G1 225 N 1 11972104 T C critical splice donor site 2 bp Het probably null phenotype 10/16/2014
3 244054 UTSW Aadac 0.000 R2265 G1 225 N 3 60037316 D136E T A missense Het probably damaging 0.999 0.647 phenotype 10/16/2014
4 244078 UTSW Abca16 0.000 R2265 G1 225 N 7 120431160 D165G A G missense Het probably benign 0.032 0.090 10/16/2014
5 244081 UTSW Adam24 0.116 R2265 G1 225 N 8 40680071 S193T T A missense Het possibly damaging 0.954 phenotype 10/16/2014
6 244048 UTSW Adra2b 0.892 R2265 G1 225 N 2 127363871 S103P T C missense Het probably damaging 1.000 phenotype 10/16/2014
7 244067 UTSW Agrn 0.541 R2265 G1 225 N 4 156179218 G173R C T missense Het probably damaging 0.989 0.647 phenotype 10/16/2014
8 244080 UTSW Alg11 1.000 R2265 G1 225 N 8 22065614 V255E T A missense Het probably benign 0.000 phenotype 10/16/2014
9 244037 UTSW Aox1 0.000 R2265 G1 225 N 1 58081520 D857E C A missense Het probably damaging 0.989 phenotype 10/16/2014
10 244100 UTSW Apob 0.916 R2265 G1 225 N 12 8015475 F4115S T C missense Het possibly damaging 0.740 0.420 phenotype 10/16/2014
11 244106 UTSW Bdkrb2 0.102 R2265 G1 225 N 12 105592225 T242A A G missense Het probably benign 0.003 phenotype 10/16/2014
12 244043 UTSW Cdca7 0.155 R2265 G1 225 N 2 72482490 L190P T C missense Het probably benign 0.011 phenotype 10/16/2014
13 244059 UTSW Cenpe 1.000 R2265 G1 225 N 3 135261636 T2180A A G missense Het probably benign 0.016 0.077 phenotype 10/16/2014
14 244071 UTSW Cep41 0.000 R2265 G1 225 N 6 30660916 I126F T A missense Het possibly damaging 0.499 phenotype 10/16/2014
15 244064 UTSW Col16a1 0.097 R2265 G1 225 N 4 130052918 H111Q C A missense Het probably benign 0.017 0.077 phenotype 10/16/2014
16 244096 UTSW Cops3 1.000 R2265 G1 225 N 11 59827890 T193A T C missense Het probably benign 0.059 phenotype 10/16/2014
17 244086 UTSW Dbr1 1.000 R2265 G1 225 N 9 99579410 V153M G A missense Het probably damaging 0.999 phenotype 10/16/2014
18 244109 UTSW Ddx4 0.801 R2265 G1 225 N 13 112621276 Y290H A G missense Het probably benign 0.080 phenotype 10/16/2014
19 244101 UTSW Dgkb 0.171 R2265 G1 225 N 12 38190108 S461R T A missense Het possibly damaging 0.606 phenotype 10/16/2014
20 244114 UTSW Dnajc28 0.000 R2265 G1 225 N 16 91616312 N372S T C missense Het probably benign 0.002 0.090 phenotype 10/16/2014
21 244038 UTSW Dner 0.000 R2265 G1 101 N 1 84585549 CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC utr 5 prime Het probably benign phenotype 10/16/2014
22 244087 UTSW Dock3 0.771 R2265 G1 225 N 9 106941326 V1190F C A missense Het probably damaging 0.999 0.647 phenotype 10/16/2014
23 244117 UTSW Exosc1 0.953 R2265 G1 225 N 19 41931418 S54P A G missense Het probably damaging 0.990 phenotype 10/16/2014
24 244089 UTSW Fbxw22 0.061 R2265 G1 225 N 9 109383994 R295K C T missense Het probably benign 0.016 0.090 10/16/2014
25 244051 UTSW Foxo1 1.000 R2265 G1 225 N 3 52345912 S499P T C missense Het probably benign 0.001 phenotype 10/16/2014
26 244103 UTSW Heatr5a 0.293 R2265 G1 225 N 12 51893745 D1444G T C missense Het possibly damaging 0.677 0.184 10/16/2014
27 244105 UTSW Hspa2 0.000 R2265 G1 225 N 12 76406188 I552S T G missense Het probably benign 0.049 phenotype 10/16/2014
28 244036 UTSW Imp4 0.954 R2265 G1 225 N 1 34443847 I173N T A missense Het probably damaging 0.996 phenotype 10/16/2014
29 244079 UTSW Itgal 0.157 R2265 G1 225 N 7 127306701 I352V A G missense Het possibly damaging 0.630 0.242 phenotype 10/16/2014
30 244099 UTSW Kcnh6 0.000 R2265 G1 225 N 11 106033817 R816Q G A missense Het probably benign 0.000 phenotype 10/16/2014
31 244115 UTSW Kcnh8 0.000 R2265 G1 143 N 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 10/16/2014
32 244049 UTSW Kcnip3 0.000 R2265 G1 225 N 2 127465061 A173D G T missense Het probably benign 0.404 phenotype 10/16/2014
33 244119 UTSW Kir3dl1 0.064 R2265 G1 222 N X 136525035 R53G A G missense Het probably benign 0.000 0.090 10/16/2014
34 244085 UTSW Klhl31 0.000 R2265 G1 225 N 9 77650158 D52G A G missense Het possibly damaging 0.820 0.187 10/16/2014
35 244074 UTSW Klk1b21 0.072 R2265 G1 225 N 7 44104439 I49T T C missense Het possibly damaging 0.506 0.179 phenotype 10/16/2014
36 244092 UTSW Lama2 0.410 R2265 G1 225 N 10 26992936 I2838F T A missense Het probably damaging 1.000 0.172 phenotype 10/16/2014
37 244093 UTSW Lilrb4a 0.176 R2265 G1 225 N 10 51491537 Y58* T A nonsense Het probably null phenotype 10/16/2014
38 244102 UTSW Lsmem1 0.066 R2265 G1 189 N 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 10/16/2014
39 244061 UTSW Mpdz 0.000 R2265 G1 225 N 4 81383391 S266P A G missense Het probably damaging 1.000 0.238 phenotype 10/16/2014
40 244098 UTSW Mrc2 0.000 R2265 G1 225 N 11 105348431 G A splice site 5 bp Het probably null 0.976 phenotype 10/16/2014
41 244062 UTSW Mroh7 0.000 R2265 G1 225 N 4 106720927 N185D T C missense Het probably benign 0.014 10/16/2014
42 244057 UTSW Mybphl 0.080 R2265 G1 225 N 3 108365001 E2G A G missense Het probably damaging 0.999 0.087 phenotype 10/16/2014
43 244110 UTSW Mycbp2 1.000 R2265 G1 225 N 14 103262749 D937G T C missense Het probably benign 0.388 phenotype 10/16/2014
44 244068 UTSW Myo18b 1.000 R2265 G1 131 N 5 112782673 M1799T A G missense Het probably damaging 1.000 phenotype 10/16/2014
45 244042 UTSW Nr4a2 1.000 R2265 G1 225 N 2 57112006 D145V T A missense Het possibly damaging 0.766 0.114 phenotype 10/16/2014
46 244041 UTSW Ntmt1 0.337 R2265 G1 140 N 2 30820460 N58K C A missense Het probably benign 0.241 0.101 phenotype 10/16/2014
47 244045 UTSW Olfr1066 0.083 R2265 G1 225 N 2 86456214 Y19C T C missense Het possibly damaging 0.771 phenotype 10/16/2014
48 244046 UTSW Olfr1278 0.059 R2265 G1 225 N 2 111293179 T304A A G missense Het probably benign 0.014 phenotype 10/16/2014
49 244063 UTSW Olfr1330 0.079 R2265 G1 225 N 4 118893874 R264W A T missense Het probably damaging 0.998 0.647 phenotype 10/16/2014
50 244113 UTSW Olfr164 0.071 R2265 G1 225 N 16 19286555 Y63H A G missense Het probably damaging 0.997 phenotype 10/16/2014
51 244075 UTSW Olfr583 0.192 R2265 G1 225 N 7 103052137 V280I G A missense Het probably benign 0.001 0.085 phenotype 10/16/2014
52 244076 UTSW Olfr659 0.113 R2265 G1 225 N 7 104670860 F53L T C missense Het probably benign 0.001 phenotype 10/16/2014
53 244077 UTSW Ovch2 0.000 R2265 G1 225 N 7 107784575 M521K A T missense Het probably damaging 0.996 10/16/2014
54 244053 UTSW P2ry13 0.000 R2265 G1 225 N 3 59210028 M110V T C missense Het probably damaging 0.999 0.223 phenotype 10/16/2014
55 244052 UTSW P2ry14 0.000 R2265 G1 225 N 3 59115571 N165S T C missense Het probably damaging 1.000 0.415 phenotype 10/16/2014
56 244116 UTSW Pcdhb19 0.074 R2265 G1 225 N 18 37497683 H177L A T missense Het probably damaging 0.989 phenotype 10/16/2014
57 244120 UTSW Phf8 0.556 R2265 G1 222 N X 151572601 L520S T C missense Het possibly damaging 0.948 0.202 phenotype 10/16/2014
58 244044 UTSW Pjvk 0.165 R2265 G1 225 N 2 76657453 S230A T G missense Het possibly damaging 0.837 phenotype 10/16/2014
59 244066 UTSW Plch2 0.000 R2265 G1 222 N 4 154993004 E423G T C missense Het probably benign 0.061 0.109 phenotype 10/16/2014
60 244069 UTSW Rad9b 1.000 R2265 G1 225 N 5 122351342 Y41C T C missense Het probably damaging 0.975 phenotype 10/16/2014
61 244112 UTSW Ranbp3l 0.105 R2265 G1 225 N 15 9057113 I286F A T missense Het probably damaging 0.987 10/16/2014
62 244050 UTSW Rtel1 1.000 R2265 G1 225 N 2 181354368 V739D T A missense Het probably damaging 1.000 phenotype 10/16/2014
63 244058 UTSW Slc35a3 0.122 R2265 G1 225 N 3 116673636 K325E T C missense Het possibly damaging 0.871 0.104 phenotype 10/16/2014
64 244055 UTSW Spag17 0.000 R2265 G1 225 N 3 100061866 C A splice site Het probably null 0.976 phenotype 10/16/2014
65 244047 UTSW Spg11 0.180 R2265 G1 207 N 2 122108307 C389S A T missense Het possibly damaging 0.479 phenotype 10/16/2014
66 244065 UTSW Srsf4 0.363 R2265 G1 225 N 4 131897682 V130A T C missense Het probably damaging 1.000 0.936 phenotype 10/16/2014
67 244091 UTSW Taar8b 0.095 R2265 G1 225 N 10 24091372 N308S T C missense Het probably damaging 0.987 0.836 10/16/2014
68 244073 UTSW Tas2r117 0.067 R2265 G1 225 N 6 132803225 C109S T A missense Het probably benign 0.060 10/16/2014
69 244039 UTSW Tlr5 0.242 R2265 G1 225 N 1 182975035 S635T T A missense Het possibly damaging 0.632 0.139 phenotype 10/16/2014
70 244090 UTSW Ttc21a 0.301 R2265 G1 225 N 9 119959008 C833F G T missense Het possibly damaging 0.623 10/16/2014
71 244040 UTSW Vash2 0.080 R2265 G1 225 N 1 190950213 N347D T C missense Het probably damaging 0.968 phenotype 10/16/2014
72 244060 UTSW Vcp 1.000 R2265 G1 225 N 4 42980833 A759V G A missense Het possibly damaging 0.925 0.128 phenotype 10/16/2014
73 244070 UTSW Vmn2r18 0.082 R2265 G1 225 N 5 151586662 E82G T C missense Het probably damaging 1.000 0.647 10/16/2014
74 244083 UTSW Vps13c 0.000 R2265 G1 225 N 9 67920947 V1461A T C missense Het possibly damaging 0.820 0.153 phenotype 10/16/2014
75 244097 UTSW Zfp616 0.000 R2265 G1 225 N 11 74085463 Y853H T C missense Het possibly damaging 0.887 10/16/2014
[records 1 to 75 of 75]