Incidental Mutations

37 incidental mutations are currently displayed, and affect 37 genes.
5 are Possibly Damaging.
14 are Probably Damaging.
10 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 37 of 37] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 271481 UTSW Adamtsl3 0.000 R3757 G1 225 Y 7 82337207 I9K T A missense Het probably benign 0.013 0.090 03/18/2015
2 271499 UTSW Arhgap31 0.299 R3757 G1 225 Y 16 38637000 E82G T C missense Het probably damaging 0.999 0.190 phenotype 03/18/2015
3 271489 UTSW Asap2 0.094 R3757 G1 225 Y 12 21267766 S993T T A missense Het probably damaging 0.998 0.279 phenotype 03/18/2015
4 271494 UTSW Bmpr1a 1.000 R3757 G1 225 Y 14 34434667 L134* A T nonsense Het probably null 0.975 phenotype 03/18/2015
5 473490 UTSW Cacna1e 0.235 R3757 G1 225 N 1 154633696 V271A A G missense Het probably damaging 0.972 phenotype 04/14/2017
6 271477 UTSW Cacna2d4 0.000 R3757 G1 225 Y 6 119241163 E153G A G missense Het probably damaging 0.977 0.251 phenotype 03/18/2015
7 271491 UTSW Cage1 0.093 R3757 G1 225 Y 13 38025729 F91V A C missense Het possibly damaging 0.711 0.147 03/18/2015
8 271495 UTSW Cdh24 0.120 R3757 G1 107 Y 14 54632180 D760G T C missense Het possibly damaging 0.915 0.147 03/18/2015
9 271464 UTSW Col9a1 0.133 R3757 G1 225 Y 1 24232231 T C critical splice donor site 2 bp Het probably null 0.947 phenotype 03/18/2015
10 271492 UTSW Cts6 0.000 R3757 G1 225 Y 13 61202158 Y36* A T nonsense Het probably null 0.976 03/18/2015
11 271496 UTSW Dennd3 0.186 R3757 G1 225 Y 15 73522234 A36G C G missense Het probably benign 0.003 0.114 03/18/2015
12 271503 UTSW Dmxl1 0.949 R3757 G1 225 Y 18 49935317 G2719D G A missense Het probably damaging 0.983 0.277 phenotype 03/18/2015
13 271501 UTSW Dnajc28 0.000 R3757 G1 225 Y 16 91616867 T187M G A missense Het probably damaging 0.998 0.647 phenotype 03/18/2015
14 271497 UTSW Ep300 1.000 R3757 G1 191 Y 15 81648589 V1676E T A missense Het unknown 0.612 phenotype 03/18/2015
15 271498 UTSW Ercc4 0.967 R3757 G1 225 Y 16 13144496 T668M C T missense Het probably benign 0.281 0.090 phenotype 03/18/2015
16 271465 UTSW G530012D18Rik 0.248 R3757 G1 190 Y 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 0.976 03/18/2015
17 271471 UTSW Gm10985 R3757 G1 107 N 3 53845224 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT frame shift Het probably null 03/18/2015
18 271486 UTSW Havcr1 0.000 R3757 G1 225 Y 11 46752580 R109L G T missense Het probably damaging 1.000 0.616 phenotype 03/18/2015
19 271490 UTSW Hist1h1e 0.000 R3757 G1 225 Y 13 23622257 K81* T A nonsense Het probably null 0.965 phenotype 03/18/2015
20 271488 UTSW Krtap4-9 0.084 R3757 G1 225 Y 11 99785618 A G unclassified Het probably benign 0.090 03/18/2015
21 271482 UTSW Layn 0.063 R3757 G1 202 Y 9 51059556 E229G T C missense Het probably benign 0.107 0.090 03/18/2015
22 271478 UTSW Lpcat3 0.237 R3757 G1 225 Y 6 124699992 T A splice site Het probably null 0.976 phenotype 03/18/2015
23 271476 UTSW Lrrn1 0.386 R3757 G1 225 Y 6 107569208 F656I T A missense Het possibly damaging 0.812 0.059 phenotype 03/18/2015
24 271466 UTSW Lypd1 0.057 R3757 G1 225 Y 1 125910384 A G splice site Het probably benign 0.090 phenotype 03/18/2015
25 271502 UTSW Olfr111 0.409 R3757 G1 225 N 17 37530355 I126N T A missense Het probably damaging 1.000 phenotype 03/18/2015
26 271468 UTSW Olfr1287 0.080 R3757 G1 225 Y 2 111449257 V39E T A missense Het possibly damaging 0.951 0.686 phenotype 03/18/2015
27 271485 UTSW Olfr777 0.087 R3757 G1 225 Y 10 129269065 D86G T C missense Het probably damaging 0.994 0.181 phenotype 03/18/2015
28 271469 UTSW Ptprt 0.123 R3757 G1 225 Y 2 161812030 L560Q A T missense Het probably damaging 1.000 0.837 phenotype 03/18/2015
29 271500 UTSW Rbm11 0.077 R3757 G1 225 Y 16 75596581 V55A T C missense Het probably damaging 1.000 0.366 03/18/2015
30 271484 UTSW Scn11a 0.113 R3757 G1 225 Y 9 119803503 V434I C T missense Het probably benign 0.159 0.074 phenotype 03/18/2015
31 271467 UTSW Serpinc1 1.000 R3757 G1 225 Y 1 161002365 T434A A G missense Het probably benign 0.002 0.063 phenotype 03/18/2015
32 271483 UTSW Setd2 0.945 R3757 G1 225 Y 9 110573685 I1798T T C missense Het probably damaging 0.991 0.416 phenotype 03/18/2015
33 271475 UTSW Sfswap 0.000 R3757 G1 225 Y 5 129513234 Y265C A G missense Het probably damaging 1.000 0.765 phenotype 03/18/2015
34 271470 UTSW Slc9a8 0.000 R3757 G1 225 Y 2 167424130 T9K C A missense Het probably benign 0.014 0.063 phenotype 03/18/2015
35 271504 UTSW Synpo 0.154 R3757 G1 225 Y 18 60602990 D389G T C missense Het probably damaging 0.999 0.078 phenotype 03/18/2015
36 271480 UTSW Vmn1r181 0.056 R3757 G1 225 Y 7 23984484 L125F C T missense Het possibly damaging 0.900 0.179 03/18/2015
37 271493 UTSW Wdfy4 0.000 R3757 G1 225 Y 14 33023374 H2296Q A C missense Het probably benign 0.171 0.088 03/18/2015
[records 1 to 37 of 37]