Incidental Mutations

26 incidental mutations are currently displayed, and affect 26 genes.
2 are Possibly Damaging.
13 are Probably Damaging.
9 are Probably Benign.
2 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 26 of 26] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 270556 UTSW Arhgap35 1.000 R3762 G1 225 N 7 16565075 S22T A T missense Het probably damaging 0.981 phenotype 03/18/2015
2 270565 UTSW Atp2b1 1.000 R3762 G1 225 N 10 99009489 I718T T C missense Het probably damaging 0.999 phenotype 03/18/2015
3 473351 UTSW Cad 0.965 R3762 G1 225 N 5 31075546 T A intron 25 bp Het probably null phenotype 04/14/2017
4 270563 UTSW Cd109 0.000 R3762 G1 188 N 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 03/18/2015
5 270551 UTSW Dhx15 0.943 R3762 G1 225 N 5 52166732 P406L G A missense Het probably benign 0.014 0.270 phenotype 03/18/2015
6 270567 UTSW Dnah17 0.000 R3762 G1 225 N 11 118104526 M999L T A missense Het probably benign 0.002 phenotype 03/18/2015
7 270559 UTSW Dpysl4 0.083 R3762 G1 225 N 7 139096756 E374G A G missense Het probably damaging 1.000 phenotype 03/18/2015
8 270562 UTSW Gatad2a R3762 G1 225 N 8 69916280 T C splice site 4 bp Het probably null phenotype 03/18/2015
9 270561 UTSW Gm15293 0.068 R3762 G1 134 N 8 21201737 S45F C T missense Het probably damaging 0.990 03/18/2015
10 473349 UTSW Gm826 0.150 R3762 G1 225 N 2 160313503 C A intron Het probably benign 04/14/2017
11 270570 UTSW H2-M10.1 0.059 R3762 G1 225 N 17 36325324 H117L T A missense Het probably damaging 0.997 03/18/2015
12 270548 UTSW Klhl9 0.000 R3762 G1 225 N 4 88721593 V137D A T missense Het possibly damaging 0.931 phenotype 03/18/2015
13 270552 UTSW Limch1 0.165 R3762 G1 225 N 5 67028840 Y828C A G missense Het probably damaging 1.000 03/18/2015
14 270566 UTSW Med1 1.000 R3762 G1 225 N 11 98155515 T C intron Het probably benign phenotype 03/18/2015
15 270560 UTSW Muc5ac 0.000 R3762 G1 225 N 7 141807475 T1507S A T missense Het possibly damaging 0.528 phenotype 03/18/2015
16 270547 UTSW Pak6 0.000 R3762 G1 225 N 2 118696477 Q651L A T missense Het probably damaging 0.993 phenotype 03/18/2015
17 270564 UTSW Plscr2 0.000 R3762 G1 225 N 9 92291080 V90D T A missense Het probably damaging 0.998 03/18/2015
18 270549 UTSW Rbbp4 1.000 R3762 G1 225 N 4 129334551 T2I G A missense Het probably damaging 0.999 phenotype 03/18/2015
19 270558 UTSW Rnf121 0.444 R3762 G1 225 N 7 102024037 T223M G A missense Het probably damaging 0.995 phenotype 03/18/2015
20 270557 UTSW Rsph6a 0.082 R3762 G1 225 N 7 19055331 K196R A G missense Het probably damaging 1.000 phenotype 03/18/2015
21 270550 UTSW Tex47 0.065 R3762 G1 225 N 5 7305529 I237L A T missense Het probably benign 0.013 03/18/2015
22 270554 UTSW Ulk1 0.000 R3762 G1 225 N 5 110789357 R691Q C T missense Het probably benign 0.033 0.090 phenotype 03/18/2015
23 270555 UTSW Vmn1r30 0.109 R3762 G1 225 N 6 58435293 V185L C A missense Het probably benign 0.205 03/18/2015
24 270569 UTSW Vmn2r103 0.060 R3762 G1 225 N 17 19812149 E728D A T missense Het probably damaging 0.977 03/18/2015
25 270553 UTSW Vmn2r14 0.149 R3762 G1 225 N 5 109220167 Y320N A T missense Het probably benign 0.023 03/18/2015
26 270568 UTSW Zc3h14 0.000 R3762 G1 225 N 12 98758643 F188Y T A missense Het probably damaging 0.996 phenotype 03/18/2015
[records 1 to 26 of 26]