Incidental Mutations

44 incidental mutations are currently displayed, and affect 44 genes.
10 are Possibly Damaging.
12 are Probably Damaging.
16 are Probably Benign.
5 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 44 of 44] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 315079 UTSW 2410004B18Rik 0.408 R4155 G1 225 N 3 145938263 F69I T A missense Het possibly damaging 0.702 0.597 05/14/2015
2 315072 UTSW Akt3 0.600 R4155 G1 225 N 1 177096977 I184T A G missense Het possibly damaging 0.919 phenotype 05/14/2015
3 500510 UTSW Arl6ip1 0.000 R4155 G1 167 N 7 118121899 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA critical splice donor site Het probably benign 0.090 phenotype 12/01/2017
4 315097 UTSW Armc2 1.000 R4155 G1 225 N 10 42011867 V40A A G missense Het probably damaging 0.963 05/14/2015
5 315088 UTSW Ash2l 1.000 R4155 G1 225 N 8 25817454 Y485H A G missense Het probably damaging 0.999 phenotype 05/14/2015
6 315095 UTSW Atr 1.000 R4155 G1 225 N 9 95888124 C1202* T A nonsense Het probably null phenotype 05/14/2015
7 315106 UTSW Bcl11b 1.000 R4155 G1 144 N 12 107917425 A T splice site Het probably null 0.976 phenotype 05/14/2015
8 315114 UTSW Birc6 1.000 R4155 G1 225 N 17 74596939 S1242R C A missense Het probably benign 0.003 phenotype 05/14/2015
9 315084 UTSW Blm 1.000 R4155 G1 127 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/14/2015
10 315092 UTSW Bsx 0.000 R4155 G1 144 N 9 40876336 E102G A G missense Het probably benign 0.040 phenotype 05/14/2015
11 315078 UTSW Casq2 0.000 R4155 G1 225 N 3 102133102 A T splice site 4 bp Het probably null phenotype 05/14/2015
12 315094 UTSW Ccpg1 0.000 R4155 G1 225 N 9 73012167 Q355K C A missense Het probably benign 0.380 0.062 05/14/2015
13 315070 UTSW Copa 0.971 R4155 G1 225 N 1 172101425 N251K T G missense Het probably damaging 1.000 phenotype 05/14/2015
14 315077 UTSW Cst8 0.051 R4155 G1 225 N 2 148800076 A31E C A missense Het possibly damaging 0.730 phenotype 05/14/2015
15 315082 UTSW D6Ertd527e 0.157 R4155 G1 225 N 6 87111524 T223S C G missense Het unknown 0.087 05/14/2015
16 315108 UTSW Ecd 1.000 R4155 G1 225 N 14 20324564 S503P A G missense Het probably damaging 0.996 0.090 phenotype 05/14/2015
17 315087 UTSW Fam155a 0.153 R4155 G1 225 N 8 9233023 Y342F T A missense Het possibly damaging 0.868 05/14/2015
18 315118 UTSW Fbn2 0.892 R4155 G1 225 N 18 58023287 E2487* C A nonsense Het probably null phenotype 05/14/2015
19 315073 UTSW Hoxd9 0.000 R4155 G1 225 N 2 74699323 I308V A G missense Het probably benign 0.147 phenotype 05/14/2015
20 315068 UTSW Ica1l 0.000 R4155 G1 225 N 1 60013893 A162V G A missense Het possibly damaging 0.710 phenotype 05/14/2015
21 315112 UTSW Kcnj15 0.000 R4155 G1 225 N 16 95296307 K263* A T nonsense Het probably null phenotype 05/14/2015
22 315116 UTSW Mettl4 0.226 R4155 G1 225 N 17 94740575 M213V T C missense Het probably benign 0.000 05/14/2015
23 315089 UTSW Ncan 0.000 R4155 G1 225 N 8 70110077 E510D C A missense Het possibly damaging 0.873 0.061 phenotype 05/14/2015
24 315107 UTSW Ndufs4 0.654 R4155 G1 225 N 13 114307854 S129R A T missense Het probably benign 0.001 0.058 phenotype 05/14/2015
25 315074 UTSW Olfr1262 0.071 R4155 G1 225 N 2 90002660 S85G A G missense Het probably benign 0.348 phenotype 05/14/2015
26 315085 UTSW Olfr305 0.105 R4155 G1 225 N 7 86364062 I92L T A missense Het probably benign 0.002 phenotype 05/14/2015
27 315086 UTSW Olfr601 0.153 R4155 G1 225 N 7 103359156 T13A T C missense Het probably benign 0.003 phenotype 05/14/2015
28 315091 UTSW Olfr933 0.057 R4155 G1 225 N 9 38976155 T160S A T missense Het probably damaging 0.989 phenotype 05/14/2015
29 315101 UTSW P2rx5 0.075 R4155 G1 225 N 11 73171829 T455A A G missense Het probably damaging 0.964 phenotype 05/14/2015
30 315117 UTSW Pcdh1 0.372 R4155 G1 225 N 18 38203106 T159S T A missense Het probably damaging 0.991 phenotype 05/14/2015
31 315081 UTSW Poln 0.000 R4155 G1 225 N 5 34009649 V755A A G missense Het possibly damaging 0.899 phenotype 05/14/2015
32 315111 UTSW Pou4f1 1.000 R4155 G1 208 N 14 104467717 S6N C T missense Het possibly damaging 0.930 phenotype 05/14/2015
33 315075 UTSW Rpap1 0.965 R4155 G1 225 N 2 119774179 R416H C T missense Het probably damaging 1.000 0.854 phenotype 05/14/2015
34 315109 UTSW Samd4 0.833 R4155 G1 225 N 14 47052946 M170K T A missense Het possibly damaging 0.740 phenotype 05/14/2015
35 315098 UTSW Srgn 0.072 R4155 G1 225 N 10 62497834 F55L A G missense Het possibly damaging 0.922 0.625 phenotype 05/14/2015
36 315083 UTSW Tmcc1 0.303 R4155 G1 225 N 6 116133804 G176D C T missense Het probably benign 0.184 05/14/2015
37 315113 UTSW Tmem232 0.076 R4155 G1 225 N 17 65436333 M321K A T missense Het probably damaging 0.968 05/14/2015
38 315110 UTSW Tnfsf11 0.422 R4155 G1 225 N 14 78299869 M118T A G missense Het probably benign 0.276 phenotype 05/14/2015
39 315069 UTSW Tns1 0.457 R4155 G1 225 N 1 73914631 N1848Y T A missense Het probably damaging 1.000 0.876 phenotype 05/14/2015
40 315115 UTSW Ttc27 0.958 R4155 G1 225 N 17 74840460 I669S T G missense Het probably benign 0.093 05/14/2015
41 315093 UTSW Uaca 0.138 R4155 G1 225 N 9 60871753 S1141G A G missense Het probably benign 0.023 0.064 phenotype 05/14/2015
42 315099 UTSW Usp34 0.673 R4155 G1 225 N 11 23417676 V1671E T A missense Het probably damaging 0.993 05/14/2015
43 315071 UTSW Wdr64 0.070 R4155 G1 225 N 1 175769606 L73H T A missense Het probably benign 0.027 05/14/2015
44 315104 UTSW Zfp410 0.231 R4155 G1 225 N 12 84327432 R181H G A missense Het probably damaging 0.997 0.679 05/14/2015
[records 1 to 44 of 44]