Incidental Mutations

44 incidental mutations are currently displayed, and affect 44 genes.
9 are Possibly Damaging.
14 are Probably Damaging.
16 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 44 of 44] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 324873 UTSW 4930578I07Rik 0.352 R4360 G1 225 Y 14 66938401 T C exon Het noncoding transcript 07/06/2015
2 324848 UTSW Adgra3 0.000 R4360 G1 225 Y 5 49990210 E496G T C missense Het possibly damaging 0.923 0.224 phenotype 07/06/2015
3 324871 UTSW Atg14 0.887 R4360 G1 131 Y 14 47568370 E13Q C G missense Het probably benign 0.004 0.071 phenotype 07/06/2015
4 324881 UTSW BC023105 0.156 R4360 G1 225 Y 18 60442001 G T exon Het noncoding transcript 07/06/2015
5 324843 UTSW Chd6 0.814 R4360 G1 225 Y 2 160949856 V2527A A G missense Het possibly damaging 0.478 0.089 phenotype 07/06/2015
6 324849 UTSW Csn1s2a 0.087 R4360 G1 225 Y 5 87781841 V100L G T missense Het possibly damaging 0.455 0.179 07/06/2015
7 324853 UTSW Fah 1.000 R4360 G1 225 Y 7 84589648 L330F G A missense Het probably damaging 1.000 0.898 phenotype 07/06/2015
8 324840 UTSW Fmo2 0.066 R4360 G1 225 Y 1 162882014 N268S T C missense Het probably damaging 0.991 0.147 phenotype 07/06/2015
9 324865 UTSW Foxg1 1.000 R4360 G1 135 Y 12 49384692 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 07/06/2015
10 324842 UTSW Frmd4a 0.183 R4360 G1 225 Y 2 4601241 H287L A T missense Het probably damaging 0.998 0.122 phenotype 07/06/2015
11 324866 UTSW G2e3 0.645 R4360 G1 225 Y 12 51363414 T A splice site Het probably benign phenotype 07/06/2015
12 324875 UTSW Gm1758 0.095 R4360 G1 225 Y 16 14506351 A T exon Het noncoding transcript 0.077 07/06/2015
13 324878 UTSW Gm7204 0.238 R4360 G1 225 Y 16 48218833 T C exon Het noncoding transcript 07/06/2015
14 324845 UTSW Gm829 0.196 R4360 G1 225 Y 4 45718819 T C exon Het noncoding transcript 0.087 07/06/2015
15 324841 UTSW Hspa14 0.228 R4360 G1 225 Y 2 3502523 V116A A G missense Het possibly damaging 0.886 0.433 07/06/2015
16 324862 UTSW Hspa4 0.878 R4360 G1 225 Y 11 53265092 Y662C T C missense Het probably damaging 1.000 0.580 phenotype 07/06/2015
17 324860 UTSW Islr 0.115 R4360 G1 225 Y 9 58157604 N207Y T A missense Het probably damaging 0.999 0.143 phenotype 07/06/2015
18 324861 UTSW Lipc 0.174 R4360 G1 225 Y 9 70852582 T C intron Het probably benign 0.090 phenotype 07/06/2015
19 324850 UTSW Ncor2 1.000 R4360 G1 225 Y 5 125028972 S1546P A G missense Het probably damaging 0.999 0.093 phenotype 07/06/2015
20 324856 UTSW Olfr539 0.056 R4360 G1 225 Y 7 140667817 F170L T C missense Het probably damaging 0.980 0.239 phenotype 07/06/2015
21 324854 UTSW Olfr679 0.103 R4360 G1 225 Y 7 105086253 E179A A C missense Het probably damaging 0.989 0.336 phenotype 07/06/2015
22 324858 UTSW Olfr830 0.169 R4360 G1 225 Y 9 18875717 C127Y G A missense Het probably damaging 1.000 0.240 phenotype 07/06/2015
23 324872 UTSW Parp4 0.152 R4360 G1 225 Y 14 56629204 D1075G A G missense Het possibly damaging 0.895 0.185 phenotype 07/06/2015
24 324876 UTSW Pkp2 1.000 R4360 G1 225 Y 16 16268682 I736V A G missense Het probably benign 0.025 0.072 phenotype 07/06/2015
25 324852 UTSW Plekha8 0.000 R4360 G1 225 Y 6 54622186 I235T T C missense Het probably benign 0.000 0.061 07/06/2015
26 324877 UTSW Polq 0.487 R4360 G1 225 Y 16 37060339 D955G A G missense Het probably benign 0.004 0.090 phenotype 07/06/2015
27 324847 UTSW Pramef25 0.060 R4360 G1 225 Y 4 143950863 F49L A G missense Het possibly damaging 0.810 0.337 07/06/2015
28 324838 UTSW Psmd1 0.964 R4360 G1 225 Y 1 86133737 K890E A G missense Het probably damaging 0.966 0.285 phenotype 07/06/2015
29 324837 UTSW Rufy4 0.294 R4360 G1 225 Y 1 74147663 C537R T C missense Het probably damaging 0.988 0.860 07/06/2015
30 324863 UTSW Scpep1 0.000 R4360 G1 225 Y 11 88930244 Y366H A G missense Het possibly damaging 0.783 0.899 phenotype 07/06/2015
31 324870 UTSW Slc18a3 0.283 R4360 G1 225 Y 14 32463925 V167A A G missense Het probably benign 0.000 0.061 phenotype 07/06/2015
32 324868 UTSW Sp8 0.808 R4360 G1 173 Y 12 118848665 D85G A G missense Het possibly damaging 0.904 0.077 phenotype 07/06/2015
33 324869 UTSW Stard3nl 0.115 R4360 G1 225 Y 13 19370484 S144L G A missense Het probably damaging 1.000 0.252 phenotype 07/06/2015
34 324844 UTSW Stk4 0.000 R4360 G1 225 Y 2 164088959 E160G A G missense Het possibly damaging 0.939 0.783 phenotype 07/06/2015
35 371051 UTSW Tbcb 0.956 R4360 G1 225 Y 7 30227035 N119S T C missense Het probably benign 0.006 0.090 02/09/2016
36 324846 UTSW Tnc 0.000 R4360 G1 225 Y 4 64016924 R592S G T missense Het probably benign 0.347 0.090 phenotype 07/06/2015
37 324880 UTSW Trem3 0.000 R4360 G1 225 Y 17 48249773 S91T T A missense Het probably benign 0.428 0.090 phenotype 07/06/2015
38 324857 UTSW Trpc6 0.000 R4360 G1 225 Y 9 8610266 E245G A G missense Het probably benign 0.100 0.080 phenotype 07/06/2015
39 324839 UTSW Usp40 0.000 R4360 G1 143 Y 1 87952361 R1036H C T missense Het probably damaging 1.000 0.647 phenotype 07/06/2015
40 324855 UTSW Usp47 0.774 R4360 G1 225 Y 7 112054932 G112C G T missense Het probably damaging 1.000 0.202 phenotype 07/06/2015
41 324864 UTSW Wdr35 1.000 R4360 G1 225 Y 12 8974149 T C utr 5 prime Het probably benign phenotype 07/06/2015
42 324867 UTSW Zc3h14 0.000 R4360 G1 225 Y 12 98780197 K555R A G missense Het probably benign 0.093 0.077 phenotype 07/06/2015
43 324859 UTSW Zfp26 0.078 R4360 G1 225 Y 9 20438573 S232G T C missense Het probably benign 0.350 0.305 phenotype 07/06/2015
44 324879 UTSW Zfp811 0.065 R4360 G1 225 Y 17 32798458 T202A T C missense Het probably benign 0.009 0.090 07/06/2015
[records 1 to 44 of 44]