Incidental Mutations

42 incidental mutations are currently displayed, and affect 42 genes.
11 are Possibly Damaging.
17 are Probably Damaging.
11 are Probably Benign.
2 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 42 of 42] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 485214 UTSW Adgb 0.000 R6118 G1 225.01 N 10 10431291 K316N T G missense Het probably damaging 0.998 08/16/2017
2 485192 UTSW Als2 0.757 R6118 G1 225.01 N 1 59203069 V609E A T missense Het possibly damaging 0.622 phenotype 08/16/2017
3 485217 UTSW Ank3 0.843 R6118 G1 189.01 N 10 69994401 I71V A G missense Het probably damaging 0.978 phenotype 08/16/2017
4 485204 UTSW Antxr2 0.108 R6118 G1 225.01 N 5 97949201 D351V T A missense Het probably damaging 0.999 phenotype 08/16/2017
5 485221 UTSW Arel1 0.625 R6118 G1 225.01 N 12 84941939 V12A A G missense Het possibly damaging 0.455 08/16/2017
6 485232 UTSW Atad1 0.313 R6118 G1 225.01 N 19 32687297 R239H C T missense Het possibly damaging 0.942 phenotype 08/16/2017
7 485224 UTSW B3galnt2 1.000 R6118 G1 225.01 N 13 13991509 T330A A G missense Het probably damaging 0.963 phenotype 08/16/2017
8 485229 UTSW Bag6 1.000 R6118 G1 225.01 N 17 35143624 I636N T A missense Het probably damaging 0.985 phenotype 08/16/2017
9 485225 UTSW C1qtnf6 0.000 R6118 G1 220.01 N 15 78525395 D84G T C missense Het probably damaging 0.991 08/16/2017
10 485208 UTSW Ceacam20 0.109 R6118 G1 225.01 N 7 19971729 V215A T C missense Het possibly damaging 0.896 08/16/2017
11 485228 UTSW Chtf18 0.518 R6118 G1 225.01 N 17 25719159 D967N C T missense Het probably damaging 0.999 phenotype 08/16/2017
12 485205 UTSW Cntnap2 0.000 R6118 G1 225.01 N 6 47193077 I1159K T A missense Het possibly damaging 0.805 phenotype 08/16/2017
13 485226 UTSW Col2a1 1.000 R6118 G1 225.01 N 15 97998567 D67G T C missense Het unknown phenotype 08/16/2017
14 485199 UTSW Csde1 0.952 R6118 G1 225.01 N 3 103054754 V627E T A missense Het probably benign 0.450 08/16/2017
15 485197 UTSW Epb41l1 0.000 R6118 G1 225.01 N 2 156522477 E969K G A missense Het probably benign 0.126 phenotype 08/16/2017
16 485222 UTSW Fam208b 0.104 R6118 G1 225.01 N 13 3581891 R870H C T missense Het possibly damaging 0.759 08/16/2017
17 485231 UTSW Fam53c 0.135 R6118 G1 225.01 N 18 34768690 E220A A C missense Het probably damaging 0.998 0.062 08/16/2017
18 485201 UTSW Gabbr2 0.167 R6118 G1 225.01 N 4 46736459 R474Q C T missense Het probably damaging 0.998 phenotype 08/16/2017
19 485218 UTSW Hap1 0.602 R6118 G1 225.01 N 11 100355794 T95N G T missense Het probably benign 0.239 phenotype 08/16/2017
20 485198 UTSW Hist2h2bb 0.370 R6118 G1 225.01 N 3 96269951 V67E T A missense Het probably damaging 0.999 phenotype 08/16/2017
21 485216 UTSW Jmjd1c 0.769 R6118 G1 225.01 N 10 67240012 K1886R A G missense Het probably damaging 1.000 phenotype 08/16/2017
22 485212 UTSW Kndc1 0.000 R6118 G1 225.01 N 7 139923802 D1007G A G missense Het probably damaging 0.997 phenotype 08/16/2017
23 485206 UTSW Mcm2 1.000 R6118 G1 225.01 N 6 88887836 A553T C T missense Het probably damaging 1.000 phenotype 08/16/2017
24 485230 UTSW Memo1 1.000 R6118 G1 225.01 N 17 74202307 Y239C T C missense Het possibly damaging 0.516 phenotype 08/16/2017
25 485220 UTSW Meox2 0.881 R6118 G1 112.47 N 12 37109031 GCACCACCACCACCACCACCA GCACCACCACCACCACCA small deletion Het probably benign phenotype 08/16/2017
26 485194 UTSW Mptx2 0.084 R6118 G1 225.01 N 1 173274847 L92F G A missense Het probably benign 0.054 0.090 08/16/2017
27 485193 UTSW Obsl1 0.232 R6118 G1 225.01 N 1 75492078 A G intron Het probably benign 08/16/2017
28 485195 UTSW Olfr1082 0.323 R6118 G1 225.01 N 2 86594414 H138L T A missense Het probably benign 0.000 phenotype 08/16/2017
29 485196 UTSW Olfr1212 0.067 R6118 G1 225.01 N 2 88959118 Y217* T A nonsense Het probably null phenotype 08/16/2017
30 485210 UTSW Pold3 1.000 R6118 G1 225.01 N 7 100096407 S180P A G missense Het possibly damaging 0.878 phenotype 08/16/2017
31 485200 UTSW Rbm12b2 0.364 R6118 G1 225.01 N 4 12095135 S665P T C missense Het probably benign 0.001 08/16/2017
32 485227 UTSW Rfc4 0.963 R6118 G1 225.01 N 16 23120943 S86T A T missense Het probably damaging 0.998 phenotype 08/16/2017
33 485215 UTSW Rfx6 1.000 R6118 G1 225.01 N 10 51711866 N277K T A missense Het possibly damaging 0.914 phenotype 08/16/2017
34 485223 UTSW Ryr2 1.000 R6118 G1 225.01 N 13 11792689 V865F C A missense Het possibly damaging 0.690 phenotype 08/16/2017
35 485202 UTSW Skint4 0.064 R6118 G1 225.01 N 4 112119822 T A splice site Het probably null 08/16/2017
36 485219 UTSW Slc38a10 0.000 R6118 G1 225.01 N 11 120132843 Y249C T C missense Het probably damaging 1.000 phenotype 08/16/2017
37 485207 UTSW Slco1b2 0.000 R6118 G1 225.01 N 6 141657510 T206A A G missense Het probably benign 0.027 phenotype 08/16/2017
38 485209 UTSW Slco3a1 0.167 R6118 G1 225.01 N 7 74318506 D489N C T missense Het probably benign 0.019 0.084 08/16/2017
39 485203 UTSW Tbc1d1 0.000 R6118 G1 225.01 N 5 64284037 L655F C T missense Het probably damaging 0.978 phenotype 08/16/2017
40 485191 UTSW Tpp2 0.570 R6118 G1 225.01 N 1 43940146 I68F A T missense Het probably damaging 0.995 phenotype 08/16/2017
41 485211 UTSW Trim30c 0.056 R6118 G1 225.01 N 7 104382081 T509K G T missense Het probably benign 0.006 08/16/2017
42 485213 UTSW Zfp827 0.665 R6118 G1 225.01 N 8 79076438 K546N G T missense Het possibly damaging 0.754 08/16/2017
[records 1 to 42 of 42]