Incidental Mutations

49 incidental mutations are currently displayed, and affect 49 genes.
11 are Possibly Damaging.
23 are Probably Damaging.
11 are Probably Benign.
1 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 49 of 49] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 487615 UTSW 4930548H24Rik 0.054 R6183 G1 225.01 N 5 31487976 (GRCm38) Y358H T C missense Het probably damaging 0.985 2017-10-10
2 487625 UTSW 5830411N06Rik 0.000 R6183 G1 225.01 N 7 140296034 (GRCm38) T404A A G missense Het possibly damaging 0.817 2017-10-10
3 487614 UTSW Abcb4 0.000 R6183 G1 225.01 N 5 8918718 (GRCm38) D352E T A missense Het probably benign 0.000 phenotype 2017-10-10
4 487606 UTSW Adgrb3 0.552 R6183 G1 225.01 N 1 25094370 (GRCm38) I972L T A missense Het probably damaging 0.980 phenotype 2017-10-10
5 487642 UTSW Alg3 0.238 R6183 G1 225.01 N 16 20610641 (GRCm38) Y33C T C missense Het probably benign 0.019 phenotype 2017-10-10
6 487623 UTSW Atp1a3 1.000 R6183 G1 225.01 N 7 24981752 (GRCm38) G816D C T missense Het probably damaging 1.000 phenotype 2017-10-10
7 487629 UTSW Ces1g 0.063 R6183 G1 225.01 N 8 93331239 (GRCm38) V145M C T missense Het possibly damaging 0.483 phenotype 2017-10-10
8 487618 UTSW Clip1 0.000 R6183 G1 203.01 N 5 123642604 (GRCm38) S339P A G missense Het probably damaging 1.000 phenotype 2017-10-10
9 487640 UTSW Col2a1 1.000 R6183 G1 225.01 N 15 97988790 (GRCm38) T378N G T missense Het unknown phenotype 2017-10-10
10 487610 UTSW Dennd4b 0.235 R6183 G1 125.47 N 3 90275568 (GRCm38) ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG utr 3 prime Het probably benign 2017-10-10
11 487637 UTSW Dnah12 0.220 R6183 G1 225.01 N 14 26861769 (GRCm38) L3207Q T A missense Het probably damaging 1.000 2017-10-10
12 487631 UTSW Efcab5 0.087 R6183 G1 225.01 N 11 77137258 (GRCm38) T416A T C missense Het probably benign 0.042 2017-10-10
13 487630 UTSW Ephb1 0.000 R6183 G1 225.01 N 9 102195325 (GRCm38) I85N A T missense Het probably damaging 0.999 phenotype 2017-10-10
14 487611 UTSW Etnppl 0.079 R6183 G1 225.01 N 3 130620317 (GRCm38) C22R T C missense Het probably damaging 1.000 2017-10-10
15 487649 UTSW F830016B08Rik 0.053 R6183 G1 225.01 N 18 60299877 (GRCm38) T11A A G missense Het probably benign 0.002 2017-10-10
16 487635 UTSW Gm5458 R6183 G1 89.01 N 14 19599644 (GRCm38) V171L C A missense Het probably damaging 0.958 2017-10-10
17 501826 UTSW Helb 0.142 R6183 G1 97.01 N 10 120112998 (GRCm38) G T splice site Het probably null phenotype 2017-12-04
18 487646 UTSW Hnrnpll 0.869 R6183 G1 225.01 N 17 80049876 (GRCm38) V237A A G missense Het possibly damaging 0.455 phenotype 2017-10-10
19 487609 UTSW Hps3 0.097 R6183 G1 225.01 N 3 20008868 (GRCm38) T712A T C missense Het probably benign 0.042 phenotype 2017-10-10
20 487617 UTSW Ibsp 0.102 R6183 G1 225.01 N 5 104306030 (GRCm38) E78G A G missense Het possibly damaging 0.953 phenotype 2017-10-10
21 487634 UTSW Ighv1-62-2 R6183 G1 92.01 N 12 115446436 (GRCm38) A111V G A missense Het probably damaging 0.965 2017-10-10
22 487619 UTSW Igkv4-63 R6183 G1 225.01 N 6 69378124 (GRCm38) Q58K G T missense Het probably damaging 1.000 2017-10-10
23 487643 UTSW Iqcg 0.000 R6183 G1 225.01 N 16 33030923 (GRCm38) Y226C T C missense Het probably damaging 0.999 phenotype 2017-10-10
24 487605 UTSW Khdc1a 0.058 R6183 G1 225.01 N 1 21350108 (GRCm38) D30V A T missense Het possibly damaging 0.804 2017-10-10
25 487626 UTSW Krtap5-5 0.486 R6183 G1 225.01 N 7 142229787 (GRCm38) C42F C A missense Het unknown 2017-10-10
26 487622 UTSW Lmod3 0.108 R6183 G1 225.01 N 6 97252553 (GRCm38) N7D T C missense Het probably damaging 0.998 phenotype 2017-10-10
27 487648 UTSW Lvrn 0.516 R6183 G1 225.01 N 18 46850685 (GRCm38) N165S A G missense Het probably benign 0.139 2017-10-10
28 487650 UTSW Ms4a4c 0.053 R6183 G1 225.01 N 19 11426229 (GRCm38) T192A A G missense Het possibly damaging 0.594 2017-10-10
29 487639 UTSW Ncald 0.000 R6183 G1 225.01 N 15 37397232 (GRCm38) V68D A T missense Het probably damaging 1.000 phenotype 2017-10-10
30 487638 UTSW Olfr1507 0.057 R6183 G1 225.01 N 14 52490731 (GRCm38) T78S T A missense Het probably benign 0.050 phenotype 2017-10-10
31 487647 UTSW Pcdhgb7 0.091 R6183 G1 225.01 N 18 37752262 (GRCm38) I162F A T missense Het probably damaging 0.967 phenotype 2017-10-10
32 487620 UTSW Prokr1 0.000 R6183 G1 179.01 N 6 87588852 (GRCm38) T4A T C missense Het possibly damaging 0.944 phenotype 2017-10-10
33 487632 UTSW Qrich2 0.067 R6183 G1 225.01 N 11 116458129 (GRCm38) T A unclassified Het probably benign 2017-10-10
34 487607 UTSW Rgl1 0.256 R6183 G1 225.01 N 1 152586570 (GRCm38) E60K C T missense Het possibly damaging 0.944 phenotype 2017-10-10
35 487633 UTSW Rtn1 0.000 R6183 G1 225.01 N 12 72408491 (GRCm38) W21R A T missense Het probably benign 0.091 phenotype 2017-10-10
36 487645 UTSW Spast 0.000 R6183 G1 225.01 N 17 74373358 (GRCm38) I438M A G missense Het probably damaging 0.986 phenotype 2017-10-10
37 487608 UTSW Sptbn5 0.258 R6183 G1 225.01 N 2 120059417 (GRCm38) C T unclassified Het probably benign 2017-10-10
38 487652 UTSW Sry 0.318 R6183 G1 222 N Y 2662975 (GRCm38) Q228H C G missense Het unknown 0.087 phenotype 2017-10-10
39 487612 UTSW Tas1r1 0.060 R6183 G1 82.01 N 4 152032541 (GRCm38) I212T A G missense Het probably damaging 0.999 phenotype 2017-10-10
40 487616 UTSW Tbc1d1 0.000 R6183 G1 225.01 N 5 64275425 (GRCm38) N439D A G missense Het probably damaging 1.000 phenotype 2017-10-10
41 487651 UTSW Tjp2 1.000 R6183 G1 158.01 N 19 24100791 (GRCm38) A913T C T missense Het probably damaging 0.992 phenotype 2017-10-10
42 487627 UTSW Tnfrsf26 0.070 R6183 G1 225.01 N 7 143611757 (GRCm38) L47P A G missense Het probably damaging 0.985 2017-10-10
43 487628 UTSW Unc13a 1.000 R6183 G1 225.01 N 8 71644666 (GRCm38) S1195T A T missense Het probably damaging 0.996 phenotype 2017-10-10
44 487636 UTSW Usp54 0.000 R6183 G1 225.01 N 14 20552245 (GRCm38) R1346G T C missense Het probably damaging 0.989 2017-10-10
45 487621 UTSW Vmn1r54 0.064 R6183 G1 225.01 N 6 90269290 (GRCm38) M62K T A missense Het possibly damaging 0.605 2017-10-10
46 487613 UTSW Vmn2r125 0.058 R6183 G1 225.01 N 4 156350069 (GRCm38) D50V A T missense Het probably damaging 0.968 2017-10-10
47 487624 UTSW Vmn2r66 0.092 R6183 G1 225.01 N 7 84995558 (GRCm38) D548G T C missense Het possibly damaging 0.810 0.179 2017-10-10
48 487644 UTSW Vmn2r95 0.081 R6183 G1 225.01 N 17 18443930 (GRCm38) N470K T A missense Het probably damaging 0.988 2017-10-10
49 487641 UTSW Zc3h7a 0.143 R6183 G1 225.01 N 16 11147370 (GRCm38) I633N A T missense Het possibly damaging 0.807 2017-10-10
[records 1 to 49 of 49]