Incidental Mutations

23 incidental mutations are currently displayed, and affect 23 genes.
3 are Possibly Damaging.
12 are Probably Damaging.
6 are Probably Benign.
2 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 23 of 23] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 518401 UTSW Abat 1.000 R6428 G1 225.01 N 16 8602436 C T intron Het probably benign phenotype 05/24/2018
2 518398 UTSW Cts6 0.000 R6428 G1 225.01 N 13 61196423 N272H T G missense Het probably damaging 0.964 05/24/2018
3 518405 UTSW Daam2 0.000 R6428 G1 225.01 N 17 49469376 E828K C T missense Het probably damaging 0.999 0.134 Daam1 conditional KO increases the severity of the heart phenotype (abnormal ventricular morphology and pressure) of the Daam1 single KO. [provided by MGI curators] (source: MGI)">phenotype 05/24/2018
4 518386 UTSW Dhx9 1.000 R6428 G1 225.01 N 1 153456578 C T unclassified Het probably benign phenotype 05/24/2018
5 518394 UTSW Glb1l3 0.070 R6428 G1 225.01 N 9 26859452 N106S T C missense Het probably damaging 0.998 05/24/2018
6 518407 UTSW Gm1141 0.123 R6428 G1 214.46 N X 71939520 CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC CATCTTTACCATCATGTCAAGTATCTTTACC unclassified Homo probably benign 05/24/2018
7 518385 UTSW Hdlbp 0.917 R6428 G1 225.01 N 1 93431445 D175G T C missense Het possibly damaging 0.912 phenotype 05/24/2018
8 518389 UTSW Hectd4 0.904 R6428 G1 225.01 N 5 121350445 K3600E A G missense Het possibly damaging 0.528 05/24/2018
9 518402 UTSW Hspa13 0.593 R6428 G1 225.01 N 16 75757986 L404Q A T missense Het probably damaging 1.000 phenotype 05/24/2018
10 518406 UTSW Iws1 0.960 R6428 G1 225.01 N 18 32086290 D475G A G missense Het probably damaging 1.000 05/24/2018
11 518390 UTSW Klhdc10 0.175 R6428 G1 225.01 N 6 30439856 S13P T C missense Het probably damaging 1.000 05/24/2018
12 518388 UTSW Lepr 0.000 R6428 G1 225.01 N 4 101780098 T728I C T missense Het probably damaging 1.000 phenotype 05/24/2018
13 518395 UTSW Ncapd3 0.964 R6428 G1 225.01 N 9 27052664 A G splice site Het probably null phenotype 05/24/2018
14 518392 UTSW Phb2 1.000 R6428 G1 225.01 N 6 124715991 D276G A G missense Het probably benign 0.003 phenotype 05/24/2018
15 518387 UTSW Prrc2b 1.000 R6428 G1 111.01 N 2 32226496 A G intron 110 bp Het probably null 05/24/2018
16 518399 UTSW Rasgrf2 0.245 R6428 G1 225.01 N 13 91987981 K604R T C missense Het probably damaging 0.999 phenotype 05/24/2018
17 518400 UTSW Rp1l1 0.154 R6428 G1 225.01 N 14 64032389 M1808K T A missense Het possibly damaging 0.921 phenotype 05/24/2018
18 518397 UTSW Setd3 0.000 R6428 G1 199.01 N 12 108113338 D302G T C missense Het probably damaging 0.994 05/24/2018
19 518396 UTSW Slc38a10 0.000 R6428 G1 225.01 N 11 120105472 Q933L T A missense Het probably benign 0.093 phenotype 05/24/2018
20 518393 UTSW Slco1a1 0.173 R6428 G1 225.01 N 6 141925690 L250S A G missense Het probably damaging 1.000 phenotype 05/24/2018
21 518403 UTSW Vmn2r106 0.104 R6428 G1 225.01 N 17 20268463 C558Y C T missense Het probably damaging 1.000 0.647 05/24/2018
22 518391 UTSW Vmn2r26 0.124 R6428 G1 225.01 N 6 124026080 I150V A G missense Het probably benign 0.172 phenotype 05/24/2018
23 518404 UTSW Zfp318 0.000 R6428 G1 225.01 N 17 46399336 R662C C T missense Het probably damaging 1.000 phenotype 05/24/2018
[records 1 to 23 of 23]