Incidental Mutations

37 incidental mutations are currently displayed, and affect 37 genes.
2 are Possibly Damaging.
11 are Probably Damaging.
15 are Probably Benign.
3 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 37 of 37] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 551742 UTSW Abcc1 0.140 R7115 G1 225.01 N 16 14437725 I636N T A missense Het probably benign 0.109 phenotype 05/15/2019
2 551726 UTSW Adam5 0.061 R7115 G1 225.01 N 8 24781696 I565T A G missense Het possibly damaging 0.691 phenotype 05/15/2019
3 551734 UTSW Amd2 R7115 G1 182.01 N 10 35711637 C A start gained Het probably benign 05/15/2019
4 551741 UTSW Ap5m1 0.000 R7115 G1 225.01 N 14 49086270 Y472* T A nonsense Het probably null 05/15/2019
5 551745 UTSW Apcdd1 0.178 R7115 G1 225.01 N 18 62936953 F97S T C missense Het probably damaging 1.000 phenotype 05/15/2019
6 551714 UTSW Axdnd1 0.099 R7115 G1 225.01 N 1 156380876 K267R T C missense Het 05/15/2019
7 551740 UTSW BC067074 0.265 R7115 G1 225.01 N 13 113320776 S1119A T G missense Het 05/15/2019
8 551710 UTSW Carf 0.000 R7115 G1 225.01 N 1 60148150 L637F G T missense Het probably damaging 0.996 phenotype 05/15/2019
9 551738 UTSW Ccdc103 0.068 R7115 G1 225.01 N 11 102883810 S95C A T missense Het possibly damaging 0.922 phenotype 05/15/2019
10 551728 UTSW Cfap20 0.964 R7115 G1 225.01 N 8 95421246 I156V T C missense Het probably benign 0.002 05/15/2019
11 551718 UTSW Csn1s2a 0.062 R7115 G1 225.01 N 5 87781805 C96R T C missense Het probably benign 0.005 05/15/2019
12 551746 UTSW Ctif 0.111 R7115 G1 132.49 N 18 75471803 CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC critical splice donor site Het probably benign phenotype 05/15/2019
13 551722 UTSW Dennd2a 0.168 R7115 G1 225.01 N 6 39506711 T405M G A missense Het probably damaging 0.995 05/15/2019
14 551725 UTSW Dennd5a 0.247 R7115 G1 225.01 N 7 109894754 Y1248H A G missense Het probably damaging 1.000 phenotype 05/15/2019
15 551715 UTSW Dnah14 0.077 R7115 G1 225.01 N 1 181720145 K2504N A T missense Het probably damaging 0.998 phenotype 05/15/2019
16 551711 UTSW Dnajb2 0.000 R7115 G1 225.01 N 1 75243662 G275D G A missense Het phenotype 05/15/2019
17 551713 UTSW Elf3 0.861 R7115 G1 225.01 N 1 135257118 D110A T G missense Het probably damaging 0.996 phenotype 05/15/2019
18 551733 UTSW Eomes 1.000 R7115 G1 225.01 N 9 118484489 N534S A G missense Het probably benign 0.001 phenotype 05/15/2019
19 551721 UTSW Fry 0.636 R7115 G1 225.01 N 5 150386067 R659W A T missense Het probably damaging 1.000 05/15/2019
20 551737 UTSW Gm10428 0.145 R7115 G1 225.01 N 11 62753380 C94Y G A missense Het unknown 05/15/2019
21 551735 UTSW Gm2696 0.528 R7115 G1 225.01 N 10 77836299 C111S T A missense Het unknown 05/15/2019
22 551727 UTSW Gpt2 0.095 R7115 G1 225.01 N 8 85518052 E325K G A missense Het probably benign 0.029 0.067 phenotype 05/15/2019
23 551716 UTSW Lrp1b 0.000 R7115 G1 225.01 N 2 40998235 N2338Y T A missense Het phenotype 05/15/2019
24 551731 UTSW Map2k1 1.000 R7115 G1 225.01 N 9 64212606 I139T A G missense Het probably damaging 0.993 phenotype 05/15/2019
25 551729 UTSW Olfr44 0.072 R7115 G1 225.01 N 9 39484648 I202V T C missense Het probably benign 0.022 phenotype 05/15/2019
26 551730 UTSW Olfr964-ps1 0.120 R7115 G1 222.01 N 9 39686707 Y79C T C missense Het probably benign 0.160 05/15/2019
27 551732 UTSW Pxylp1 0.000 R7115 G1 225.01 N 9 96825010 T373I G A missense Het probably benign 0.023 05/15/2019
28 551739 UTSW Ranbp9 0.950 R7115 G1 225.01 N 13 43406671 N484S T C missense Het probably benign 0.035 phenotype 05/15/2019
29 551712 UTSW Rassf5 0.133 R7115 G1 225.01 N 1 131181249 V293A A G missense Het probably benign 0.209 phenotype 05/15/2019
30 551744 UTSW Ring1 0.654 R7115 G1 225.01 N 17 34023446 I29T A G missense Het probably damaging 0.971 phenotype 05/15/2019
31 551717 UTSW Scn1a 1.000 R7115 G1 225.01 N 2 66324618 Q666* G A nonsense Het probably null phenotype 05/15/2019
32 551743 UTSW Spice1 0.000 R7115 G1 225.01 N 16 44379275 G697R G A missense Het probably benign 0.003 05/15/2019
33 551723 UTSW Tas2r131 0.000 R7115 G1 225.01 N 6 132957604 F81L A G missense Het probably benign 0.067 05/15/2019
34 551736 UTSW Tenm2 0.501 R7115 G1 225.01 N 11 36163817 S572L G A missense Het probably damaging 0.992 phenotype 05/15/2019
35 551720 UTSW Tfr2 0.000 R7115 G1 225.01 N 5 137571715 T128A A G missense Het probably benign 0.000 phenotype 05/15/2019
36 551719 UTSW Trim56 0.000 R7115 G1 225.01 N 5 137113660 Q334L T A missense Het probably damaging 0.975 05/15/2019
37 551724 UTSW Vmn2r44 R7115 G1 225.01 N 7 8367528 R840* T A nonsense Het probably null 05/15/2019
[records 1 to 37 of 37]