Incidental Mutations

78 incidental mutations are currently displayed, and affect 78 genes.
13 are Possibly Damaging.
21 are Probably Damaging.
24 are Probably Benign.
15 are Probably Null.
4 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 78 of 78] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 574584 UTSW 1110008L16Rik 0.558 R7208 G1 71.01 Y 12 55308645 A G intron Het probably null 09/18/2019
2 560860 UTSW Aass 0.000 R7208 G1 225.01 Y 6 23074630 K854E T C missense Het probably damaging 0.993 phenotype 06/26/2019
3 560894 UTSW Abcd2 0.105 R7208 G1 225.01 Y 15 91190682 Y309* G T nonsense Het probably null phenotype 06/26/2019
4 560856 UTSW Ache 0.714 R7208 G1 225.01 Y 5 137291489 G360D G A missense Het probably damaging 1.000 phenotype 06/26/2019
5 560883 UTSW Acot12 0.068 R7208 G1 140.01 Y 13 91781242 L396P T C missense Het probably benign 0.065 06/26/2019
6 560885 UTSW Acox2 0.118 R7208 G1 225.01 Y 14 8241303 D603A T G missense Het probably benign 0.272 phenotype 06/26/2019
7 560872 UTSW Adam3 0.000 R7208 G1 225.01 Y 8 24711401 K245N C A missense Het probably damaging 0.978 0.022 phenotype 06/26/2019
8 560905 UTSW Ankhd1 0.000 R7208 G1 225.01 Y 18 36625028 I925T T C missense Het probably benign 0.000 06/26/2019
9 560877 UTSW Arhgap27 0.143 R7208 G1 225.01 Y 11 103360759 V48M C T missense Het probably damaging 1.000 phenotype 06/26/2019
10 574583 UTSW Atm 0.873 R7208 G1 225.01 Y 9 53512008 A T intron Het probably null phenotype 09/18/2019
11 560897 UTSW B4galt4 0.221 R7208 G1 225.01 Y 16 38753940 F92Y T A missense Het probably damaging 1.000 phenotype 06/26/2019
12 560901 UTSW Brwd1 0.000 R7208 G1 225.01 Y 16 96035959 R891Q C T missense Het probably damaging 0.999 0.174 phenotype 06/26/2019
13 560858 UTSW Calcr 0.000 R7208 G1 225.01 Y 6 3687612 Q462R T C missense Het probably benign 0.002 phenotype 06/26/2019
14 560906 UTSW Ccdc112 0.183 R7208 G1 225.01 Y 18 46287631 R351G T C missense Het probably damaging 0.997 0.188 06/26/2019
15 560898 UTSW Ccdc80 0.100 R7208 G1 225.01 Y 16 45096710 S610A T G missense Het probably benign 0.117 phenotype 06/26/2019
16 560839 UTSW Cdh20 0.264 R7208 G1 225.01 Y 1 104954071 N420K C A missense Het possibly damaging 0.633 phenotype 06/26/2019
17 560861 UTSW Cntn3 0.000 R7208 G1 225.01 Y 6 102278422 R172* G A nonsense Het probably null 06/26/2019
18 560844 UTSW Ctnnd1 1.000 R7208 G1 225.01 Y 2 84622046 Q78K G T missense Het possibly damaging 0.479 phenotype 06/26/2019
19 560899 UTSW D16Ertd472e 0.000 R7208 G1 225.01 Y 16 78575926 L41H A T missense Het probably damaging 0.994 06/26/2019
20 574579 UTSW Dclk2 0.000 R7208 G1 225.01 Y 3 86799602 A T splice site Het probably null phenotype 09/18/2019
21 560865 UTSW Dmwd 0.152 R7208 G1 225.01 Y 7 19080309 H295Y C T missense Het probably benign 0.046 06/26/2019
22 560878 UTSW Dnaic2 0.102 R7208 G1 225.01 Y 11 114757162 V588A T C missense Het unknown phenotype 06/26/2019
23 560907 UTSW Dtx4 0.494 R7208 G1 225.01 Y 19 12482073 C T critical splice donor site 1 bp Het probably null 06/26/2019
24 560875 UTSW Dync2h1 1.000 R7208 G1 225.01 Y 9 7141059 D1323Y C A missense Het probably damaging 1.000 0.500 phenotype 06/26/2019
25 560866 UTSW Fcgbp 0.000 R7208 G1 225.01 Y 7 28104021 H1683Q T A missense Het probably benign 0.006 06/26/2019
26 560908 UTSW Fndc3c1 0.093 R7208 G1 222 Y X 106435073 L724V G C missense Het possibly damaging 0.551 0.062 06/26/2019
27 560871 UTSW Gm4070 R7208 G1 120.01 N 7 105902179 S555R A C missense Het possibly damaging 0.580 06/26/2019
28 560889 UTSW Gm9195 0.195 R7208 G1 225.01 Y 14 72451752 S1876P A G missense Het possibly damaging 0.934 06/26/2019
29 560891 UTSW Grhl2 1.000 R7208 G1 225.01 Y 15 37335736 K431T A C missense Het probably damaging 1.000 phenotype 06/26/2019
30 560862 UTSW Grm7 0.000 R7208 G1 225.01 Y 6 111358569 I647S T G missense Het possibly damaging 0.939 phenotype 06/26/2019
31 560855 UTSW Gtf2ird1 0.691 R7208 G1 225.01 Y 5 134411094 N94S T C missense Het probably benign 0.355 phenotype 06/26/2019
32 560884 UTSW Hmgcs1 0.922 R7208 G1 225.01 Y 13 119701084 G195W G T missense Het probably damaging 0.998 06/26/2019
33 560869 UTSW Hrc 0.000 R7208 G1 225.01 Y 7 45336565 Y380F A T missense Het possibly damaging 0.528 phenotype 06/26/2019
34 560873 UTSW Kcnu1 0.000 R7208 G1 225.01 Y 8 25919637 Q863* C T nonsense Het probably null phenotype 06/26/2019
35 560903 UTSW Lemd2 1.000 R7208 G1 225.01 Y 17 27196191 P300L G A missense Het probably damaging 1.000 0.390 phenotype 06/26/2019
36 560902 UTSW Lnpep 0.000 R7208 G1 225.01 Y 17 17552910 Y665* A T nonsense Het probably null 0.562 phenotype 06/26/2019
37 560867 UTSW Lrfn1 0.403 R7208 G1 225.01 Y 7 28467139 T653A A G missense Het probably benign 0.000 06/26/2019
38 560904 UTSW Ly6g6c 0.133 R7208 G1 225.01 Y 17 35067411 T8A A G missense Het unknown phenotype 06/26/2019
39 560874 UTSW Mcm5 1.000 R7208 G1 225.01 Y 8 75121716 T C critical splice donor site 2 bp Het probably null 0.544 phenotype 06/26/2019
40 560854 UTSW Med28 1.000 R7208 G1 225.01 Y 5 45523452 D86V A T missense Het probably damaging 0.998 06/26/2019
41 560847 UTSW Mup11 R7208 G1 225.01 N 4 60659726 S171P A G missense Het possibly damaging 0.800 06/26/2019
42 560843 UTSW Nckap1 1.000 R7208 G1 225.01 Y 2 80540198 F383L A G missense Het probably benign 0.244 phenotype 06/26/2019
43 560881 UTSW Nid1 0.167 R7208 G1 225.01 Y 13 13468385 G303R G C missense Het probably benign 0.007 phenotype 06/26/2019
44 560846 UTSW Nkain3 0.100 R7208 G1 225.01 Y 4 20282892 V147A A G missense Het probably benign 0.008 phenotype 06/26/2019
45 560842 UTSW Olfr361 0.103 R7208 G1 225.01 Y 2 37085658 V30A A G missense Het probably benign 0.259 phenotype 06/26/2019
46 574590 UTSW Pde9a 0.248 R7208 G1 114.01 Y 17 31420284 V63I G A missense Het possibly damaging 0.455 0.062 phenotype 09/18/2019
47 560888 UTSW Pdlim2 0.087 R7208 G1 225.01 Y 14 70174377 I69F T A missense Het probably damaging 1.000 phenotype 06/26/2019
48 560859 UTSW Peg10 1.000 R7208 G1 119.47 N 6 4756398 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG small deletion Het probably benign phenotype 06/26/2019
49 560892 UTSW Phf20l1 0.338 R7208 G1 225.01 Y 15 66604789 I245T T C missense Het probably benign 0.049 06/26/2019
50 560864 UTSW Prmt8 0.000 R7208 G1 225.01 Y 6 127689829 R394H C T missense Het possibly damaging 0.807 phenotype 06/26/2019
51 560882 UTSW Prpf4b 1.000 R7208 G1 225.01 Y 13 34884011 D274E T A missense Het unknown phenotype 06/26/2019
52 574586 UTSW Psmd6 0.967 R7208 G1 225.01 Y 14 14112225 A T utr 3 prime Het probably null phenotype 09/18/2019
53 560840 UTSW Rgs16 0.068 R7208 G1 225.01 Y 1 153741670 L69P T C missense Het probably damaging 1.000 phenotype 06/26/2019
54 560876 UTSW Robo3 1.000 R7208 G1 225.01 Y 9 37424724 I482N A T missense Het probably damaging 0.994 phenotype 06/26/2019
55 560887 UTSW Scara3 0.081 R7208 G1 225.01 Y 14 65931266 V301I C T missense Het possibly damaging 0.620 phenotype 06/26/2019
56 560880 UTSW Serpina1b 0.133 R7208 G1 225.01 Y 12 103728294 H397L T A missense Het probably benign 0.039 phenotype 06/26/2019
57 560850 UTSW Skint11 0.067 R7208 G1 225.01 Y 4 114231747 L246Q T A missense Het probably damaging 0.999 06/26/2019
58 560849 UTSW Skint5 0.088 R7208 G1 225.01 Y 4 113539339 R1212S T A missense Het unknown 06/26/2019
59 560895 UTSW Slc11a2 0.551 R7208 G1 225.01 Y 15 100402332 D348G T C missense Het probably benign 0.001 phenotype 06/26/2019
60 560896 UTSW Slc15a2 0.093 R7208 G1 225.01 Y 16 36756281 K495E T C missense Het probably benign 0.022 phenotype 06/26/2019
61 560900 UTSW Son 0.955 R7208 G1 225.01 Y 16 91662102 D2072E T G missense Het unknown 0.066 phenotype 06/26/2019
62 560845 UTSW Stau1 0.000 R7208 G1 225.01 Y 2 166963574 V34A A G missense Het probably damaging 0.977 phenotype 06/26/2019
63 560890 UTSW Stk3 0.000 R7208 G1 225.01 Y 15 35073116 L153I G T missense Het possibly damaging 0.756 phenotype 06/26/2019
64 560841 UTSW Swi5 0.138 R7208 G1 225.01 Y 2 32287910 V13E A T missense Het probably benign 0.007 06/26/2019
65 574585 UTSW Syne2 0.535 R7208 G1 225.01 Y 12 76031398 A T splice site 3 bp Het probably null phenotype 09/18/2019
66 560870 UTSW Synm 0.000 R7208 G1 225.01 Y 7 67734915 M558V T C missense Het probably benign 0.006 phenotype 06/26/2019
67 560886 UTSW Tep1 0.000 R7208 G1 225.01 Y 14 50824556 T A critical splice acceptor site Het probably null phenotype 06/26/2019
68 560879 UTSW Tmc6 0.000 R7208 G1 225.01 Y 11 117776325 V149A A G missense Het probably benign 0.408 phenotype 06/26/2019
69 560853 UTSW Tmem214 0.587 R7208 G1 225.01 Y 5 30870721 V95E T A missense Het possibly damaging 0.522 06/26/2019
70 574578 UTSW Tnnt2 1.000 R7208 G1 225.01 Y 1 135850376 T A splice site Het probably null phenotype 09/18/2019
71 560851 UTSW Txlna 0.177 R7208 G1 225.01 Y 4 129631278 A G critical splice donor site 2 bp Het probably null 0.520 06/26/2019
72 560863 UTSW Vmn2r26 0.347 R7208 G1 225.01 Y 6 124061989 I841T T C missense Het probably damaging 1.000 phenotype 06/26/2019
73 560852 UTSW Wasf2 1.000 R7208 G1 225.01 Y 4 133195734 V452I G A missense Het probably damaging 0.998 0.252 phenotype 06/26/2019
74 560868 UTSW Wdr62 0.000 R7208 G1 225.01 Y 7 30252336 D673N C T missense Het probably damaging 0.971 phenotype 06/26/2019
75 560848 UTSW Wdr78 0.085 R7208 G1 225.01 Y 4 103066352 I427L T G missense Het probably benign 0.002 06/26/2019
76 560857 UTSW Wdr95 0.076 R7208 G1 225.01 Y 5 149595371 T559I C T missense Het probably benign 0.018 0.134 06/26/2019
77 574581 UTSW Zbtb40 0.120 R7208 G1 225.01 Y 4 136999626 A T splice site Het probably null 0.575 09/18/2019
78 560893 UTSW Zfat 1.000 R7208 G1 225.01 Y 15 68180007 E646G T C missense Het probably benign 0.390 phenotype 06/26/2019
[records 1 to 78 of 78]