Incidental Mutations

76 incidental mutations are currently displayed, and affect 75 genes.
8 are Possibly Damaging.
22 are Probably Damaging.
29 are Probably Benign.
10 are Probably Null.
7 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 566535 UTSW 2310050C09Rik 0.087 R7293 G1 225.01 Y 3 92868819 C186S A T missense Het probably benign 0.322 06/26/2019
2 566593 UTSW Abcc2 0.000 R7293 G1 225.01 Y 19 43807053 G416E G A missense Het probably damaging 1.000 phenotype 06/26/2019
3 566594 UTSW Acsl5 0.000 R7293 G1 225.01 Y 19 55291210 W460L G T missense Het probably damaging 0.982 phenotype 06/26/2019
4 566585 UTSW Adam2 0.000 R7293 G1 225.01 Y 14 66035185 F614S A G missense Het probably benign 0.294 phenotype 06/26/2019
5 566590 UTSW Adamts5 0.248 R7293 G1 225.01 Y 16 85899945 T108I G A missense Het probably benign 0.100 phenotype 06/26/2019
6 566542 UTSW Agmat 0.095 R7293 G1 225.01 Y 4 141755935 Q227* C T nonsense Het probably null 06/26/2019
7 566556 UTSW Alg11 1.000 R7293 G1 225.01 Y 8 22065379 N219D A G missense Het probably damaging 1.000 phenotype 06/26/2019
8 566588 UTSW Amhr2 0.839 R7293 G1 225.01 Y 15 102447393 T258A A G missense Het probably benign 0.002 phenotype 06/26/2019
9 566546 UTSW Ankrd53 0.000 R7293 G1 225.01 Y 6 83763196 E82G A G missense Het probably null 1.000 06/26/2019
10 566523 UTSW Blzf1 0.169 R7293 G1 225.01 Y 1 164295883 T292S T A missense Het possibly damaging 0.913 06/26/2019
11 566536 UTSW Capza1 0.462 R7293 G1 225.01 Y 3 104840835 D71G T C missense Het probably benign 0.000 phenotype 06/26/2019
12 566540 UTSW Cc2d1b 0.444 R7293 G1 225.01 Y 4 108631676 F770L T C missense Het probably benign 0.399 06/26/2019
13 566552 UTSW Cckbr 0.076 R7293 G1 225.01 Y 7 105434645 Q260L A T missense Het probably benign 0.054 phenotype 06/26/2019
14 566566 UTSW Cep162 0.157 R7293 G1 225.01 Y 9 87203783 T1163A T C missense Het probably benign 0.006 06/26/2019
15 566559 UTSW Chd9 0.000 R7293 G1 225.01 Y 8 91034079 S2151P T C missense Het unknown 06/26/2019
16 566520 UTSW Clk1 0.000 R7293 G1 225.01 Y 1 58414613 T301S T A missense Het probably benign 0.001 0.060 phenotype 06/26/2019
17 566579 UTSW Cmya5 0.326 R7293 G1 225.01 Y 13 93092797 S1928C T A missense Het possibly damaging 0.905 06/26/2019
18 566537 UTSW Col24a1 0.000 R7293 G1 225.01 Y 3 145486304 Q1273* C T nonsense Het probably null phenotype 06/26/2019
19 566521 UTSW Col4a4 0.099 R7293 G1 225.01 N 1 82523943 D363G T C missense Het unknown phenotype 06/26/2019
20 566553 UTSW Copb1 0.953 R7293 G1 225.01 Y 7 114219602 M827K A T missense Het probably damaging 0.998 phenotype 06/26/2019
21 566541 UTSW Crocc 0.446 R7293 G1 225.01 Y 4 141043556 A351T C T missense Het probably benign 0.175 phenotype 06/26/2019
22 566568 UTSW Crybg1 1.000 R7293 G1 225.01 Y 10 44003432 T587A T C missense Het probably damaging 0.997 06/26/2019
23 566526 UTSW Csrnp3 0.162 R7293 G1 225.01 Y 2 65949000 R19G A G missense Het probably damaging 1.000 phenotype 06/26/2019
24 566539 UTSW Cyb5rl 0.128 R7293 G1 225.01 Y 4 107080946 I165T T C missense Het probably damaging 0.980 06/26/2019
25 566580 UTSW Dnah1 0.000 R7293 G1 225.01 Y 14 31287863 I1916N A T missense Het probably damaging 0.995 phenotype 06/26/2019
26 566543 UTSW Dvl1 0.000 R7293 G1 225.01 Y 4 155856168 M415T T C missense Het possibly damaging 0.931 phenotype 06/26/2019
27 566561 UTSW Dync2h1 1.000 R7293 G1 225.01 Y 9 7001454 S3845P A G missense Het possibly damaging 0.878 phenotype 06/26/2019
28 566545 UTSW Eif3b 1.000 R7293 G1 203.01 Y 5 140419428 Q23R A G missense Het probably benign 0.000 phenotype 06/26/2019
29 566564 UTSW Esam 0.166 R7293 G1 225.01 Y 9 37537724 R376L G T missense Het probably damaging 0.996 phenotype 06/26/2019
30 566562 UTSW Fat3 0.493 R7293 G1 225.01 Y 9 15915040 H391D G C missense Het phenotype 06/26/2019
31 566563 UTSW Fat3 0.493 R7293 G1 225.01 Y 9 15915296 S305R A C missense Het phenotype 06/26/2019
32 566578 UTSW Fgd3 0.085 R7293 G1 191.01 Y 13 49264658 D644G T C missense Het probably benign 0.005 06/26/2019
33 566530 UTSW Fgf7 0.000 R7293 G1 225.01 Y 2 126035752 L13P T C missense Het probably damaging 1.000 phenotype 06/26/2019
34 566571 UTSW Gas2l1 0.000 R7293 G1 225.01 Y 11 5064338 Y41H A G missense Het probably damaging 0.999 phenotype 06/26/2019
35 566560 UTSW Glg1 0.718 R7293 G1 225.01 Y 8 111168743 I812N A T missense Het probably damaging 1.000 phenotype 06/26/2019
36 566592 UTSW Glp1r 0.000 R7293 G1 225.01 Y 17 30924625 H212Y C T missense Het probably benign 0.001 phenotype 06/26/2019
37 566581 UTSW Gm5622 0.057 R7293 G1 215.01 Y 14 51655882 E89* G T nonsense Het probably null 0.976 06/26/2019
38 566525 UTSW Gpr158 0.000 R7293 G1 225.01 Y 2 21576939 V410I G A missense Het possibly damaging 0.466 06/26/2019
39 566574 UTSW Ighv1-53 0.203 R7293 G1 225.01 Y 12 115158821 C5* A T nonsense Het probably null 06/26/2019
40 566591 UTSW Itgb2l 0.098 R7293 G1 225.01 Y 16 96426796 Y502* A C nonsense Het probably null phenotype 06/26/2019
41 566544 UTSW Jakmip1 0.512 R7293 G1 225.01 Y 5 37127473 V635I G A missense Het probably benign 0.001 phenotype 06/26/2019
42 566572 UTSW Krt23 0.066 R7293 G1 225.01 Y 11 99483856 M270I C T missense Het probably benign 0.000 phenotype 06/26/2019
43 566534 UTSW Larp1b 0.000 R7293 G1 225.01 Y 3 40985444 A344V C T missense Het 06/26/2019
44 566569 UTSW Lin28b R7293 G1 225.01 Y 10 45419186 M134V T C missense Het probably benign 0.000 phenotype 06/26/2019
45 566538 UTSW Lrrc19 0.069 R7293 G1 225.01 Y 4 94638390 Y310F T A missense Het probably benign 0.067 06/26/2019
46 566575 UTSW Lyst 0.282 R7293 G1 225.01 Y 13 13680237 D2397E T A missense Het probably benign 0.014 phenotype 06/26/2019
47 566550 UTSW Map6 0.162 R7293 G1 225.01 Y 7 99336533 N751S A G missense Het possibly damaging 0.490 phenotype 06/26/2019
48 566589 UTSW Mgrn1 0.000 R7293 G1 225.01 Y 16 4932220 D494N G A missense Het probably benign 0.008 phenotype 06/26/2019
49 566583 UTSW Myh6 1.000 R7293 G1 225.01 Y 14 54947174 F1567L A G missense Het probably benign 0.001 phenotype 06/26/2019
50 566558 UTSW Myo9b 0.540 R7293 G1 225.01 Y 8 71325905 V461A T C missense Het probably benign 0.001 phenotype 06/26/2019
51 566557 UTSW Ncan 0.000 R7293 G1 225.01 Y 8 70115211 S84T A T missense Het probably damaging 0.982 phenotype 06/26/2019
52 566549 UTSW Nlrp9a 0.063 R7293 G1 225.01 Y 7 26571269 C908Y G A missense Het probably damaging 1.000 06/26/2019
53 566528 UTSW Olfr1264 0.270 R7293 G1 225.01 Y 2 90021527 Y180N A T missense Het probably damaging 1.000 phenotype 06/26/2019
54 591025 UTSW Olfr1289 0.115 R7293 G1 225.01 Y 2 111483354 A G splice site Het probably null phenotype 11/11/2019
55 566551 UTSW Olfr659 0.090 R7293 G1 225.01 Y 7 104670718 N5K T A missense Het probably damaging 1.000 phenotype 06/26/2019
56 566565 UTSW Olfr949-ps1 R7293 G1 225.01 Y 9 39364834 M92L A T missense Het probably benign 0.013 06/26/2019
57 566584 UTSW Parp4 0.142 R7293 G1 139.47 N 14 56647846 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC small deletion Het probably benign phenotype 06/26/2019
58 566533 UTSW Pld1 0.000 R7293 G1 225.01 Y 3 28087286 T666K C A missense Het probably damaging 0.993 phenotype 06/26/2019
59 566555 UTSW Pnpla6 1.000 R7293 G1 225.01 Y 8 3538068 Y1107C A G missense Het probably damaging 1.000 phenotype 06/26/2019
60 566527 UTSW Pramel7 0.082 R7293 G1 225.01 Y 2 87492362 N19K A C missense Het probably benign 0.278 06/26/2019
61 566547 UTSW Prh1 R7293 G1 225.01 Y 6 132571758 P76R C G missense Het unknown phenotype 06/26/2019
62 566548 UTSW Prkd2 0.000 R7293 G1 225.01 Y 7 16845940 V121A T C missense Het possibly damaging 0.878 phenotype 06/26/2019
63 566570 UTSW Ptprq 0.513 R7293 G1 225.01 Y 10 107635506 Q1345* G A nonsense Het probably null phenotype 06/26/2019
64 566529 UTSW Ryr3 0.397 R7293 G1 225.01 Y 2 112902603 T653S T A missense Het probably benign 0.132 phenotype 06/26/2019
65 566582 UTSW Sall2 0.000 R7293 G1 225.01 Y 14 52314411 Y442* G T nonsense Het probably null phenotype 06/26/2019
66 566531 UTSW Slc23a2 1.000 R7293 G1 225.01 Y 2 132089106 F158V A C missense Het probably benign 0.021 phenotype 06/26/2019
67 566554 UTSW Smg1 1.000 R7293 G1 225.01 Y 7 118166099 R1954L C A missense Het unknown phenotype 06/26/2019
68 566587 UTSW Snx31 0.000 R7293 G1 225.01 Y 15 36523450 T362I G A missense Het probably damaging 0.968 06/26/2019
69 566524 UTSW Taf3 0.962 R7293 G1 225.01 Y 2 9952090 T422K G T missense Het probably damaging 0.984 phenotype 06/26/2019
70 566532 UTSW Tcfl5 0.197 R7293 G1 94.01 Y 2 180642165 D142G T C missense Het probably benign 0.080 06/26/2019
71 566573 UTSW Tmx1 0.196 R7293 G1 225.01 Y 12 70460551 T188A A G missense Het probably damaging 0.979 phenotype 06/26/2019
72 566522 UTSW Tnfrsf11a 0.146 R7293 G1 225.01 Y 1 105808141 A G critical splice acceptor site Het probably null phenotype 06/26/2019
73 566586 UTSW Trio 1.000 R7293 G1 225.01 Y 15 27871289 C640S A T missense Het possibly damaging 0.663 phenotype 06/26/2019
74 566567 UTSW Ulk4 0.772 R7293 G1 172.01 Y 9 121255124 N427T T G missense Het probably damaging 1.000 phenotype 06/26/2019
75 566576 UTSW Vmn1r202 0.084 R7293 G1 225.01 Y 13 22501702 M182V T C missense Het probably benign 0.003 06/26/2019
76 566577 UTSW Vmn1r214 0.067 R7293 G1 225.01 Y 13 23034669 A111V C T missense Het probably benign 0.411 06/26/2019
[records 1 to 76 of 76]