Incidental Mutations

52 incidental mutations are currently displayed, and affect 52 genes.
8 are Possibly Damaging.
13 are Probably Damaging.
22 are Probably Benign.
6 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 605917 UTSW Acan 1.000 R7835 G1 225.01 Y 7 79099875 S1465T T A missense Het probably benign 0.075 phenotype 12/20/2019
2 605900 UTSW Accsl 0.066 R7835 G1 225.01 Y 2 93865984 K90* T A nonsense Het probably null 12/20/2019
3 605906 UTSW Adamts3 1.000 R7835 G1 225.01 Y 5 89700440 D674E A T missense Het possibly damaging 0.702 0.103 phenotype 12/20/2019
4 605931 UTSW Adap2 0.081 R7835 G1 225.01 Y 11 80160231 V129D T A missense Het probably benign 0.112 phenotype 12/20/2019
5 605927 UTSW Ank3 0.820 R7835 G1 225.01 Y 10 69987727 D742G A G missense Het phenotype 12/20/2019
6 605911 UTSW C1ra 0.000 R7835 G1 225.01 N 6 124517725 E316K G A missense Het probably benign 0.000 0.079 12/20/2019
7 605921 UTSW C330021F23Rik R7835 G1 225.01 Y 8 3580452 A G intron Het probably benign 12/20/2019
8 628640 UTSW Cachd1 0.295 R7835 G1 225.01 Y 4 100974153 G T splice site 5 bp Het probably null 06/01/2020
9 605915 UTSW Ccne1 0.000 R7835 G1 225.01 Y 7 38102845 Q133K G T missense Het probably benign 0.027 phenotype 12/20/2019
10 605916 UTSW Cers3 0.325 R7835 G1 225.01 Y 7 66773639 H111Y C T missense Het possibly damaging 0.786 phenotype 12/20/2019
11 605923 UTSW Chst5 0.000 R7835 G1 225.01 Y 8 111890602 L129M A T missense Het probably damaging 1.000 phenotype 12/20/2019
12 605901 UTSW Depdc7 0.259 R7835 G1 225.01 Y 2 104728185 S164P A G missense Het probably benign 0.001 12/20/2019
13 605907 UTSW Dnah10 0.000 R7835 G1 225.01 Y 5 124777234 A1966T G A missense Het probably damaging 1.000 0.251 phenotype 12/20/2019
14 605937 UTSW Fam208a 1.000 R7835 G1 225.01 Y 14 27476643 G1311C G T missense Het probably damaging 1.000 phenotype 12/20/2019
15 605914 UTSW Fcgbp 0.000 R7835 G1 225.01 Y 7 28117207 S2365A T G missense Het possibly damaging 0.638 0.171 12/20/2019
16 605897 UTSW Ihh 1.000 R7835 G1 225.01 Y 1 74946366 V320A A G missense Het probably damaging 0.982 phenotype 12/20/2019
17 605945 UTSW Kdm5d 0.071 R7835 G1 222 Y Y 900558 V201A T C missense Het possibly damaging 0.635 0.179 phenotype 12/20/2019
18 605938 UTSW Kif13b 0.000 R7835 G1 225.01 Y 14 64767452 H1117Q T A missense Het probably benign 0.001 0.085 phenotype 12/20/2019
19 628639 UTSW Lcn8 0.058 R7835 G1 225.01 Y 2 25655296 C A splice site Het probably null phenotype 06/01/2020
20 605899 UTSW Lrp4 0.823 R7835 G1 225.01 Y 2 91495042 V1404A T C missense Het possibly damaging 0.820 phenotype 12/20/2019
21 605908 UTSW Lrrc61 0.062 R7835 G1 225.01 Y 6 48568572 T110S A T missense Het probably benign 0.003 12/20/2019
22 605910 UTSW Mrpl19 0.917 R7835 G1 225.01 Y 6 81962126 R232C G A missense Het probably damaging 1.000 phenotype 12/20/2019
23 605920 UTSW Muc5ac 0.000 R7835 G1 149.01 N 7 141809303 G2117A G C missense Het unknown phenotype 12/20/2019
24 605939 UTSW Mzt1 0.893 R7835 G1 144.01 Y 14 99046003 T21A T C missense Het probably benign 0.029 12/20/2019
25 605936 UTSW Naip6 0.153 R7835 G1 225.01 Y 13 100316004 A183E G T missense Het probably benign 0.187 phenotype 12/20/2019
26 605898 UTSW Neb 0.864 R7835 G1 225.01 Y 2 52150577 D6624G T C missense Het probably benign 0.295 0.090 phenotype 12/20/2019
27 605932 UTSW Nup85 1.000 R7835 G1 225.01 Y 11 115570071 D183G A G missense Het probably benign 0.351 phenotype 12/20/2019
28 605918 UTSW Olfm5 0.075 R7835 G1 225.01 Y 7 104154445 Y195* A T nonsense Het probably null 0.976 12/20/2019
29 605924 UTSW Olfr828 0.158 R7835 G1 225.01 Y 9 18815809 M162L T A missense Het probably benign 0.054 phenotype 12/20/2019
30 605944 UTSW Piezo2 1.000 R7835 G1 225.01 Y 18 63082945 F1216I A T missense Het probably benign 0.115 0.066 phenotype 12/20/2019
31 605922 UTSW Pkd1l3 0.000 R7835 G1 214.46 N 8 109624195 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA small deletion Het probably benign 0.085 phenotype 12/20/2019
32 605909 UTSW Polr1a 1.000 R7835 G1 225.01 Y 6 71915142 V135A T C missense Het probably benign 0.020 phenotype 12/20/2019
33 605926 UTSW Ppcdc 0.961 R7835 G1 225.01 Y 9 57420276 S83P A G missense Het probably benign 0.017 phenotype 12/20/2019
34 605941 UTSW Prss21 0.059 R7835 G1 225.01 Y 17 23869451 Q130L A T missense Het possibly damaging 0.568 phenotype 12/20/2019
35 605925 UTSW Rdx 0.000 R7835 G1 225.01 Y 9 52065788 N112K T A missense Het probably damaging 0.975 0.137 phenotype 12/20/2019
36 605940 UTSW Rgs22 0.000 R7835 G1 225.01 Y 15 36081911 A G critical splice donor site 2 bp Het probably null 0.949 12/20/2019
37 605929 UTSW Rps26 R7835 G1 225.01 Y 10 128626126 V40I C T missense Het probably benign 0.023 phenotype 12/20/2019
38 605942 UTSW Runx2 1.000 R7835 G1 225.01 Y 17 44608236 M405K A T missense Het probably damaging 0.991 0.510 phenotype 12/20/2019
39 605904 UTSW Serinc2 0.099 R7835 G1 225.01 Y 4 130275487 C4G A C missense Het unknown 12/20/2019
40 605943 UTSW Sh3rf2 0.000 R7835 G1 225.01 Y 18 42111170 R266S C A missense Het probably benign 0.254 12/20/2019
41 605934 UTSW Slc38a10 0.000 R7835 G1 225.01 Y 11 120116996 I386T A G missense Het possibly damaging 0.948 phenotype 12/20/2019
42 605928 UTSW Stab2 0.000 R7835 G1 225.01 Y 10 86872619 P1694L G A missense Het probably benign 0.062 phenotype 12/20/2019
43 605903 UTSW Taf4 1.000 R7835 G1 117.01 Y 2 179932029 T682M G A missense Het probably damaging 1.000 0.223 phenotype 12/20/2019
44 605930 UTSW Tmem102 0.165 R7835 G1 225.01 Y 11 69804345 V267A A G missense Het probably damaging 0.999 12/20/2019
45 605933 UTSW Trim65 0.000 R7835 G1 225.01 Y 11 116130929 L26P A G missense Het probably damaging 1.000 12/20/2019
46 605913 UTSW Vmn1r160 R7835 G1 131.01 N 7 22871954 M244K T A missense Het possibly damaging 0.900 12/20/2019
47 605912 UTSW Vmn1r57 0.061 R7835 G1 225.01 Y 7 5221139 H221L A T missense Het probably benign 0.440 12/20/2019
48 605935 UTSW Wdr89 0.000 R7835 G1 225.01 Y 12 75632899 V194F C A missense Het probably damaging 1.000 0.633 phenotype 12/20/2019
49 605919 UTSW Wee1 1.000 R7835 G1 225.01 Y 7 110130878 Y396* C A nonsense Het probably null phenotype 12/20/2019
50 605896 UTSW Zfp451 0.000 R7835 G1 225.01 Y 1 33772979 V885D A T missense Het probably damaging 1.000 0.883 12/20/2019
51 605905 UTSW Zfp981 0.084 R7835 G1 131.01 Y 4 146537876 Q419H A T missense Het probably benign 0.009 12/20/2019
52 605902 UTSW Znfx1 0.000 R7835 G1 225.01 Y 2 167039827 Y1081H A G missense Het probably damaging 1.000 12/20/2019
[records 1 to 52 of 52]