Incidental Mutations

48 incidental mutations are currently displayed, and affect 47 genes.
6 are Possibly Damaging.
19 are Probably Damaging.
14 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 640155 UTSW Afap1l1 0.071 R8253 G1 225.01 N 18 61741631 E493G T C missense Het probably benign 0.427 07/28/2020
2 640120 UTSW Akr1a1 0.345 R8253 G1 225.01 N 4 116636643 D313E A T missense Het probably damaging 0.979 phenotype 07/28/2020
3 640134 UTSW Ap1m1 1.000 R8253 G1 225.01 N 8 72252886 V242E T A missense Het probably damaging 0.998 phenotype 07/28/2020
4 640144 UTSW Atad2b 0.000 R8253 G1 225.01 N 12 4974159 S670T T A missense Het possibly damaging 0.541 phenotype 07/28/2020
5 640145 UTSW Atad2b 0.000 R8253 G1 225.01 N 12 4974160 S670L C T missense Het probably benign 0.023 phenotype 07/28/2020
6 640110 UTSW Avpr1b 0.076 R8253 G1 225.01 N 1 131609416 T313S A T missense Het probably benign 0.410 phenotype 07/28/2020
7 640126 UTSW Cblc 0.000 R8253 G1 201.01 N 7 19786232 I362T A G missense Het probably damaging 1.000 phenotype 07/28/2020
8 640117 UTSW Ccdc171 0.153 R8253 G1 225.01 N 4 83742970 S1106T T A missense Het probably damaging 0.986 phenotype 07/28/2020
9 640113 UTSW Csde1 0.956 R8253 G1 225.01 N 3 103038721 N10K C A missense Het probably damaging 0.978 07/28/2020
10 640135 UTSW Csnk2a2 0.765 R8253 G1 112.01 N 8 95488377 Y24C T C missense Het phenotype 07/28/2020
11 640138 UTSW Cyb5r4 0.000 R8253 G1 225.01 N 9 87059055 L420F G T missense Het probably damaging 0.999 phenotype 07/28/2020
12 640150 UTSW Cyth4 0.155 R8253 G1 225.01 N 15 78602737 I22V A G missense Het probably benign 0.093 phenotype 07/28/2020
13 640152 UTSW Dnah8 0.428 R8253 G1 214.46 N 17 30760867 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT frame shift Het probably null phenotype 07/28/2020
14 640109 UTSW Dner 0.000 R8253 G1 225.01 N 1 84534877 G323E C T missense Het probably damaging 1.000 phenotype 07/28/2020
15 640149 UTSW Elf1 0.355 R8253 G1 225.01 N 14 79536352 M1T T C start codon destroyed Het probably null 0.675 phenotype 07/28/2020
16 640140 UTSW Fam13c 0.166 R8253 G1 225.01 N 10 70553203 S520P T C missense Het probably damaging 1.000 07/28/2020
17 640131 UTSW Fam160a2 0.000 R8253 G1 225.01 N 7 105379087 H885L T A missense Het possibly damaging 0.539 phenotype 07/28/2020
18 640123 UTSW Gabra2 0.073 R8253 G1 225.01 N 5 71092070 I30T A G missense Het probably benign 0.004 phenotype 07/28/2020
19 640136 UTSW Gm6793 R8253 G1 225.01 N 8 112015008 M1L T A start codon destroyed Het probably benign 0.001 07/28/2020
20 640133 UTSW Inpp5a 1.000 R8253 G1 225.01 N 7 139481640 L76P T C missense Het probably damaging 0.988 phenotype 07/28/2020
21 640111 UTSW Itih5 0.064 R8253 G1 225.01 N 2 10238595 I381T T C missense Het probably benign 0.058 phenotype 07/28/2020
22 640143 UTSW Lyrm7 0.124 R8253 G1 225.01 N 11 54850401 I36V T C missense Het probably null 0.999 phenotype 07/28/2020
23 640121 UTSW Magi2 1.000 R8253 G1 225.01 N 5 20609307 I906V A G missense Het probably benign 0.435 phenotype 07/28/2020
24 640116 UTSW Mup5 0.132 R8253 G1 201.01 N 4 61834574 A71T C T missense Het probably benign 0.003 07/28/2020
25 640115 UTSW Ndufaf6 0.305 R8253 G1 225.01 N 4 11059086 R248W G A missense Het probably damaging 1.000 phenotype 07/28/2020
26 640132 UTSW Olfr469 0.091 R8253 G1 225.01 N 7 107822569 I300T A G missense Het probably damaging 0.982 phenotype 07/28/2020
27 640130 UTSW Olfr619 0.059 R8253 G1 225.01 N 7 103604331 I226L A T missense Het possibly damaging 0.877 phenotype 07/28/2020
28 640141 UTSW Palm 0.000 R8253 G1 225.01 N 10 79807677 K80* A T nonsense Het probably null phenotype 07/28/2020
29 640125 UTSW Pcyox1 0.000 R8253 G1 225.01 N 6 86389062 R390K C T missense Het probably benign 0.000 phenotype 07/28/2020
30 640124 UTSW Pdx1 1.000 R8253 G1 225.01 N 5 147270649 T C critical splice donor site 2 bp Het probably null phenotype 07/28/2020
31 640114 UTSW Pifo 0.079 R8253 G1 225.01 N 3 105998367 M193V T C missense Het probably benign 0.000 phenotype 07/28/2020
32 640151 UTSW Pkp2 1.000 R8253 G1 225.01 N 16 16268542 V689D T A missense Het probably damaging 0.998 phenotype 07/28/2020
33 640139 UTSW Prkar2a 0.000 R8253 G1 225.01 N 9 108740439 R232L G T missense Het probably damaging 1.000 phenotype 07/28/2020
34 640128 UTSW Rasgrp4 0.000 R8253 G1 225.01 N 7 29138862 T87M C T missense Het possibly damaging 0.632 phenotype 07/28/2020
35 640147 UTSW Ryr2 1.000 R8253 G1 225.01 N 13 11827553 Q486L T A missense Het possibly damaging 0.942 phenotype 07/28/2020
36 640153 UTSW Shd 0.276 R8253 G1 225.01 N 17 55976295 V309A T C missense Het 07/28/2020
37 640119 UTSW Skint7 0.057 R8253 G1 225.01 N 4 111977478 Q20* C T nonsense Het probably null 07/28/2020
38 640156 UTSW Slc35g1 0.000 R8253 G1 225.01 N 19 38402789 T173K C A missense Het probably damaging 1.000 phenotype 07/28/2020
39 640122 UTSW Slit2 1.000 R8253 G1 225.01 N 5 48275671 F1073L T C missense Het probably benign 0.004 phenotype 07/28/2020
40 640148 UTSW Snx18 0.178 R8253 G1 225.01 N 13 113594781 D559V T A missense Het probably damaging 0.998 phenotype 07/28/2020
41 640112 UTSW Tbr1 1.000 R8253 G1 225.01 N 2 61805241 Q178H G T missense Het probably benign 0.156 phenotype 07/28/2020
42 640127 UTSW Tmem145 0.101 R8253 G1 225.01 N 7 25307514 Y114D T G missense Het probably damaging 0.999 phenotype 07/28/2020
43 640118 UTSW Ttc22 0.067 R8253 G1 225.01 N 4 106638520 L357P T C missense Het probably damaging 0.993 0.182 phenotype 07/28/2020
44 640129 UTSW Uba2 1.000 R8253 G1 225.01 N 7 34150898 M377V T C missense Het probably damaging 0.959 phenotype 07/28/2020
45 640137 UTSW Vps13c 0.000 R8253 G1 225.01 N 9 67943488 Y2242* T A nonsense Het probably null phenotype 07/28/2020
46 640154 UTSW Xdh 0.386 R8253 G1 211.01 N 17 73918382 Q475P T G missense Het possibly damaging 0.935 phenotype 07/28/2020
47 640142 UTSW Xrcc6bp1 0.309 R8253 G1 225.01 N 10 126868674 G197S C T missense Het probably benign 0.428 07/28/2020
48 640146 UTSW Zbtb42 0.000 R8253 G1 225.01 N 12 112680312 L307R T G missense Het probably damaging 1.000 phenotype 07/28/2020
[records 1 to 48 of 48]