Incidental Mutations

61 incidental mutations are currently displayed, and affect 60 genes.
7 are Possibly Damaging.
23 are Probably Damaging.
20 are Probably Benign.
5 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 61 of 61] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 641737 UTSW 1700007G11Rik 0.107 R8317 G1 225.01 N 5 98737600 H122P A C missense Het probably benign 0.208 07/28/2020
2 641776 UTSW 1700029P11Rik 0.345 R8317 G1 225.01 N 15 81980777 Y73C A G missense Het probably damaging 1.000 07/28/2020
3 641769 UTSW Adgrv1 0.000 R8317 G1 225.01 N 13 81575117 V621M C T missense Het probably damaging 0.981 phenotype 07/28/2020
4 641726 UTSW Adipor1 0.000 R8317 G1 225.01 N 1 134428167 R235W C T missense Het probably benign 0.029 phenotype 07/28/2020
5 641744 UTSW Agbl1 0.000 R8317 G1 225.01 N 7 76422181 M594K T A missense Het unknown phenotype 07/28/2020
6 641725 UTSW Als2cr12 0.050 R8317 G1 225.01 N 1 58676548 K170E T C missense Het possibly damaging 0.944 07/28/2020
7 641774 UTSW Ang2 0.065 R8317 G1 225.01 N 14 51195892 V11A A G missense Het probably benign 0.339 07/28/2020
8 641783 UTSW BC027072 0.112 R8317 G1 225.01 N 17 71749202 L1160R A C missense Het probably benign 0.100 phenotype 07/28/2020
9 641751 UTSW Ccl25 0.051 R8317 G1 225.01 N 8 4354138 N80S A G missense Het probably benign 0.004 phenotype 07/28/2020
10 641748 UTSW Cd19 0.740 R8317 G1 225.01 N 7 126413443 C259* A T nonsense Het probably null phenotype 07/28/2020
11 641750 UTSW Cd209b 0.047 R8317 G1 225.01 N 8 3922018 I177N A T missense Het probably damaging 0.992 phenotype 07/28/2020
12 641734 UTSW Cdc20 1.000 R8317 G1 225.01 N 4 118437126 C A unclassified Het probably benign phenotype 07/28/2020
13 641758 UTSW Cdh23 0.598 R8317 G1 225.01 N 10 60311258 A T critical splice donor site 2 bp Het probably null phenotype 07/28/2020
14 641759 UTSW Cdh23 0.598 R8317 G1 225.01 N 10 60436789 R536W G A missense Het probably damaging 0.997 phenotype 07/28/2020
15 641729 UTSW Chd6 0.772 R8317 G1 225.01 N 2 160990321 D977G T C missense Het probably damaging 1.000 phenotype 07/28/2020
16 641763 UTSW Csl 0.549 R8317 G1 225.01 N 10 99759038 H55P T G missense Het probably damaging 0.999 07/28/2020
17 641785 UTSW Cstf2t 0.456 R8317 G1 225.01 N 19 31084248 A395T G A missense Het probably benign 0.090 phenotype 07/28/2020
18 641765 UTSW Dhx58 0.270 R8317 G1 225.01 N 11 100703562 I101N A T missense Het probably damaging 1.000 phenotype 07/28/2020
19 641772 UTSW Dlg5 1.000 R8317 G1 225.01 N 14 24191230 S200A A C missense Het probably damaging 0.980 phenotype 07/28/2020
20 641735 UTSW Epb41 0.000 R8317 G1 225.01 N 4 131957650 G86V C A missense Het phenotype 07/28/2020
21 641731 UTSW Fat4 1.000 R8317 G1 225.01 N 3 38958510 V2318A T C missense Het possibly damaging 0.802 phenotype 07/28/2020
22 641775 UTSW Fbxo32 0.000 R8317 G1 225.01 N 15 58205230 F119I A T missense Het probably damaging 0.997 phenotype 07/28/2020
23 641782 UTSW Fndc1 0.075 R8317 G1 225.01 N 17 7800888 L153* A T nonsense Het probably null 07/28/2020
24 641742 UTSW Foxp1 1.000 R8317 G1 115.47 N 6 99075905 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG small deletion Het probably benign phenotype 07/28/2020
25 641749 UTSW Gm4559 0.137 R8317 G1 100.53 N 7 142273816 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT small deletion Het probably benign 07/28/2020
26 641733 UTSW Gpr63 0.000 R8317 G1 225.01 N 4 25008223 T316S A T missense Het probably damaging 1.000 phenotype 07/28/2020
27 641755 UTSW Ick 0.776 R8317 G1 225.01 N 9 78153651 V193E T A missense Het probably damaging 0.977 phenotype 07/28/2020
28 641745 UTSW Il16 0.204 R8317 G1 225.01 N 7 83655330 T665A T C missense Het probably benign 0.000 phenotype 07/28/2020
29 641730 UTSW Lama5 1.000 R8317 G1 225.01 N 2 180206991 N272S T C missense Het probably damaging 0.999 phenotype 07/28/2020
30 641771 UTSW Map3k1 0.914 R8317 G1 225.01 N 13 111758162 Y660C T C missense Het probably damaging 1.000 phenotype 07/28/2020
31 641753 UTSW Mbd3l1 0.000 R8317 G1 225.01 N 9 18484821 L81I C A missense Het probably benign 0.008 phenotype 07/28/2020
32 641781 UTSW Morc3 1.000 R8317 G1 225.01 N 16 93862529 Q442K C A missense Het probably benign 0.247 phenotype 07/28/2020
33 641754 UTSW Muc16 0.189 R8317 G1 225.01 N 9 18658043 T1060I G A missense Het unknown phenotype 07/28/2020
34 641778 UTSW Myh11 1.000 R8317 G1 225.01 N 16 14208077 D1343V T A missense Het phenotype 07/28/2020
35 641780 UTSW Myh15 0.188 R8317 G1 225.01 N 16 49120018 T777N C A missense Het probably damaging 0.986 07/28/2020
36 641732 UTSW Nbn 1.000 R8317 G1 225.01 N 4 15970893 L292W T G missense Het probably damaging 0.957 phenotype 07/28/2020
37 641728 UTSW Nebl 0.000 R8317 G1 225.01 N 2 17350757 M195T A G missense Het possibly damaging 0.711 07/28/2020
38 641766 UTSW Net1 0.299 R8317 G1 225.01 N 13 3907856 K66E T C missense Het possibly damaging 0.860 phenotype 07/28/2020
39 641740 UTSW Nod1 0.000 R8317 G1 225.01 N 6 54943440 Y631C T C missense Het probably damaging 0.998 phenotype 07/28/2020
40 641784 UTSW Nxf1 1.000 R8317 G1 225.01 N 19 8771043 H12R A G missense Het probably benign 0.000 phenotype 07/28/2020
41 641760 UTSW Onecut3 0.000 R8317 G1 207.01 N 10 80495327 L107P T C missense Het unknown phenotype 07/28/2020
42 641779 UTSW Opa1 1.000 R8317 G1 225.01 N 16 29614144 I512S T G missense Het probably damaging 0.999 phenotype 07/28/2020
43 641743 UTSW P3h3 0.000 R8317 G1 225.01 N 6 124855153 G257R C T missense Het probably damaging 0.998 0.198 phenotype 07/28/2020
44 641727 UTSW Pappa2 0.000 R8317 G1 225.01 N 1 158764960 C1616R A G missense Het probably damaging 1.000 phenotype 07/28/2020
45 641777 UTSW Parn 0.962 R8317 G1 225.01 N 16 13541100 K593Q T G missense Het probably damaging 0.965 phenotype 07/28/2020
46 641770 UTSW Polr3g 1.000 R8317 G1 225.01 N 13 81678183 K173R T C missense Het unknown 07/28/2020
47 641747 UTSW Prcp 0.069 R8317 G1 225.01 N 7 92875390 T18A A G missense Het probably benign 0.055 phenotype 07/28/2020
48 641757 UTSW Sash1 1.000 R8317 G1 225.01 N 10 8729386 T1080M G A missense Het possibly damaging 0.765 phenotype 07/28/2020
49 641739 UTSW Skap2 1.000 R8317 G1 225.01 N 6 51907885 A G critical splice donor site 2 bp Het probably null phenotype 07/28/2020
50 641764 UTSW Srebf1 1.000 R8317 G1 225.01 N 11 60200657 S1014I C A missense Het possibly damaging 0.622 phenotype 07/28/2020
51 641736 UTSW Stk32b 0.107 R8317 G1 225.01 N 5 37454975 E356K C T missense Het probably damaging 0.986 phenotype 07/28/2020
52 641741 UTSW Tex37 0.000 R8317 G1 225.01 N 6 70913292 W172L C A missense Het possibly damaging 0.847 07/28/2020
53 641762 UTSW Tjp3 0.000 R8317 G1 225.01 N 10 81280490 T257S T A missense Het probably benign 0.111 phenotype 07/28/2020
54 641756 UTSW Trf 1.000 R8317 G1 225.01 N 9 103217516 Y448H A G missense Het probably damaging 0.995 phenotype 07/28/2020
55 641752 UTSW Tsnaxip1 0.612 R8317 G1 225.01 N 8 105827806 R7P G C missense Het probably benign 0.067 07/28/2020
56 641767 UTSW Vmn1r208 0.069 R8317 G1 225.01 N 13 22772777 I183M G C missense Het probably benign 0.045 07/28/2020
57 641746 UTSW Vmn2r67 0.114 R8317 G1 225.01 N 7 85136626 M724L T A missense Het probably benign 0.104 07/28/2020
58 641773 UTSW Wdhd1 1.000 R8317 G1 225.01 N 14 47263537 H469Q A T missense Het probably damaging 0.998 phenotype 07/28/2020
59 641761 UTSW Zbtb7a 1.000 R8317 G1 225.01 N 10 81144950 G326A G C missense Het probably benign 0.177 phenotype 07/28/2020
60 641768 UTSW Zfp493 0.085 R8317 G1 225.01 N 13 67783839 R19H G A missense Het probably benign 0.420 07/28/2020
61 641738 UTSW Zfp932 0.058 R8317 G1 225.01 N 5 110009056 K207* A T nonsense Het probably null 07/28/2020
[records 1 to 61 of 61]