Incidental Mutations

2,997 incidental mutations are currently displayed, and affect 2,289 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
267 are Probably Benign.
2,713 are Probably Null.
0 create premature stop codons.
2,997 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 2997] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 192678 UTSW 1110017D15Rik 0.000 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.949 phenotype 05/23/2014
2 602860 UTSW 1500015O10Rik 0.000 RF007 G1 214.46 N 1 43737192 TTCTGTA T critical splice acceptor site Het probably benign phenotype 12/04/2019
3 604985 UTSW 1500015O10Rik 0.000 RF045 G1 214.46 N 1 43737192 TTCTGTA T critical splice acceptor site Het probably benign phenotype 12/04/2019
4 192500 UTSW 1700001C02Rik 0.000 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
5 538049 UTSW 1700011H14Rik 0.052 R6841 G1 225.01 Y 14 49243813 T C critical splice acceptor site Het probably null 10/18/2018
6 388197 UTSW 1700017D01Rik 0.072 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.976 06/06/2016
7 478683 UTSW 1700019A02Rik 0.139 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
8 190952 UTSW 1700023F06Rik 0.049 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
9 409841 APN 1700029H14Rik 0.000 IGL03069 8 13557704 T G critical splice acceptor site Het probably null 08/02/2016
10 39342 UTSW 1700067P10Rik 0.063 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.976 05/23/2013
11 626508 UTSW 1700093K21Rik 0.071 Z1177 225.01 N 11 23518144 T A critical splice acceptor site Het probably null phenotype 01/23/2020
12 379571 UTSW 2010111I01Rik 0.097 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.947 phenotype 04/15/2016
13 26543 UTSW 2010315B03Rik 0.066 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
14 60600 UTSW 2010315B03Rik 0.066 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
15 60571 UTSW 2010315B03Rik 0.066 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
16 22264 UTSW 2010315B03Rik 0.066 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
17 500098 UTSW 2010315B03Rik 0.066 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
18 31421 UTSW 2010315B03Rik 0.066 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
19 76984 UTSW 2010315B03Rik 0.066 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
20 76493 UTSW 2010315B03Rik 0.066 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
21 89620 APN 2300002M23Rik 0.120 IGL01527 G1 17 35567833 G T critical splice acceptor site Het probably null phenotype 12/03/2013
22 406142 UTSW 2310022A10Rik 0.129 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.950 07/28/2016
23 559734 UTSW 2700049A03Rik 1.000 R7193 G1 225.01 Y 12 71219189 A G critical splice acceptor site Het probably null phenotype 06/26/2019
24 180063 APN 2700062C07Rik 0.927 IGL01919 G1 18 24475523 A G critical splice acceptor site Het probably null 05/07/2014
25 632713 UTSW 3110002H16Rik 0.726 R8144 G1 176.01 Y 18 12185647 A T critical splice acceptor site Het probably null phenotype 06/30/2020
26 208042 UTSW 4430402I18Rik 0.109 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.950 06/23/2014
27 462735 UTSW 4833423E24Rik 0.078 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.976 03/01/2017
28 278029 APN 4921507P07Rik 0.058 IGL00852 G1 6 50589184 T A critical splice acceptor site Het probably null 04/16/2015
29 382658 UTSW 4921507P07Rik 0.058 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
30 318775 UTSW 4921524L21Rik 0.083 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
31 370200 UTSW 4930430A15Rik 0.058 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.949 02/04/2016
32 507928 UTSW 4930452B06Rik 0.078 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably null 0.949 03/15/2018
33 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
34 647535 UTSW 4930505A04Rik 0.000 R8394 G1 225.01 N 11 30454880 T A critical splice acceptor site Het probably null 09/02/2020
35 482208 UTSW 4930579C12Rik 0.073 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
36 629634 UTSW 4931423N10Rik 0.069 R8086 G1 225.01 Y 2 23240922 A G critical splice acceptor site Het probably null 0.976 06/30/2020
37 511096 UTSW 4932438A13Rik 1.000 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
38 511596 UTSW 4932438A13Rik 1.000 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
39 53494 APN 4932438A13Rik 1.000 IGL01019 G1 3 37006984 G T critical splice acceptor site Het probably null phenotype 06/28/2013
40 212811 UTSW 4932438A13Rik 1.000 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
41 532627 UTSW 4932438A13Rik 1.000 R6792 G1 225.01 Y 3 37011566 A G critical splice acceptor site Het probably null phenotype 08/29/2018
42 596970 UTSW 4932438A13Rik 1.000 R7748 G1 225.01 N 3 36959335 A G critical splice acceptor site Het probably null phenotype 11/26/2019
43 603314 UTSW 4932438A13Rik 1.000 RF013 G1 217.47 N 3 37050757 TTAT TTATTATTATTATTAGTAT critical splice acceptor site Het probably benign phenotype 12/04/2019
44 603455 UTSW 4932438A13Rik 1.000 RF015 G1 214.46 N 3 37050748 TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT critical splice acceptor site Het probably benign phenotype 12/04/2019
45 603867 UTSW 4932438A13Rik 1.000 RF021 G1 217.73 N 3 37050748 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT critical splice acceptor site Het probably benign phenotype 12/04/2019
46 603979 UTSW 4932438A13Rik 1.000 RF023 G1 217.47 N 3 37050760 T TTATTATTATTATTAG critical splice acceptor site Het probably benign phenotype 12/04/2019
47 604479 UTSW 4932438A13Rik 1.000 RF034 G1 217.47 N 3 37050760 T TTATTATGATTATTAC critical splice acceptor site Het probably benign phenotype 12/04/2019
48 604520 UTSW 4932438A13Rik 1.000 RF035 G1 217.47 N 3 37050758 TAT TATTATTATTATTATGAT critical splice acceptor site Het probably benign phenotype 12/04/2019
49 605225 UTSW 4932438A13Rik 1.000 RF055 G1 217.47 N 3 37050757 TTAT TTATTATTATTATTAGTAT critical splice acceptor site Het probably benign phenotype 12/04/2019
50 57694 UTSW 5430403G16Rik 0.074 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 0.825 07/11/2013
51 241496 UTSW 5430419D17Rik 0.000 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.976 10/15/2014
52 241616 UTSW 5430419D17Rik 0.000 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.976 10/15/2014
53 249756 UTSW 5830473C10Rik 0.054 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
54 634637 UTSW 9030617O03Rik 0.149 R8181 G1 225.01 Y 12 100850111 A G critical splice acceptor site Het probably null 07/13/2020
55 617408 UTSW 9130011E15Rik 1.000 R8021 G1 225.01 Y 19 45956741 C T critical splice acceptor site Het probably null 01/23/2020
56 376254 UTSW 9930111J21Rik1 0.068 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
57 420239 APN A2m 0.000 IGL03369 6 121676903 G A critical splice acceptor site Het probably null phenotype 08/02/2016
58 436215 UTSW A2ml1 0.000 R5532 G1 225 N 6 128553330 T A critical splice acceptor site Het probably null 10/24/2016
59 166432 UTSW A430105I19Rik 0.000 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
60 565276 UTSW A430105I19Rik 0.000 R7271 G1 225.01 Y 2 118760683 T A critical splice acceptor site Het probably null 0.949 06/26/2019
61 391994 UTSW A530016L24Rik 0.017 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 0.976 06/08/2016
62 564038 UTSW A730017C20Rik 0.000 R7252 G1 225.01 Y 18 59066908 A G critical splice acceptor site Het probably null 0.976 06/26/2019
63 345326 UTSW A830018L16Rik 0.056 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably null phenotype 09/25/2015
64 479514 UTSW A830018L16Rik 0.056 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably null 0.949 phenotype 06/26/2017
65 588386 UTSW A930009A15Rik 0.142 R7607 G1 225.01 Y 10 115581989 G A critical splice acceptor site Het probably null 10/24/2019
66 302040 APN Aadacl4 0.065 IGL02648 4 144617822 A T critical splice acceptor site Het probably null 04/16/2015
67 102103 UTSW Aak1 0.560 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null phenotype 01/15/2014
68 479868 UTSW Aanat 0.063 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably null 0.971 phenotype 06/26/2017
69 621532 UTSW Aasdh 0.176 Z1176 225.01 N 5 76891796 C G critical splice acceptor site Het probably null phenotype 01/23/2020
70 204589 UTSW Aass 0.000 R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null phenotype 06/23/2014
71 12430 APN Abca12 1.000 IGL00813 G1 1 71353762 C A critical splice acceptor site Het probably null phenotype 12/06/2012
72 658833 UTSW Abca12 1.000 R8527 G1 225.01 N 1 71309888 C T critical splice acceptor site Het probably null phenotype 01/18/2021
73 659395 UTSW Abca12 1.000 R8542 G1 225.01 Y 1 71309888 C T critical splice acceptor site Het probably null phenotype 01/18/2021
74 489401 UTSW Abca13 0.000 R6153 G1 225.01 Y 11 9301259 G T critical splice acceptor site Het probably null 0.948 phenotype 10/10/2017
75 4474 APN Abca5 0.142 IGL00487 G1 11 110309450 T A critical splice acceptor site Het probably null phenotype 04/20/2012
76 603425 UTSW Abca5 0.142 RF014 G1 225.01 Y 11 110279754 T C critical splice acceptor site Het probably null phenotype 12/04/2019
77 349067 UTSW Abca6 0.000 R4629 G1 225 N 11 110230549 T C critical splice acceptor site Het probably null phenotype 10/08/2015
78 588073 UTSW Abca7 0.000 R7602 G1 225.01 Y 10 79998012 A G critical splice acceptor site Het probably null phenotype 10/24/2019
79 217018 UTSW Abca8a 0.075 R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
80 486155 UTSW Abca8a 0.075 R6090 G1 225.01 N 11 110063222 T C critical splice acceptor site Het probably null 08/16/2017
81 204725 UTSW Abca8b 0.000 R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably null 0.948 phenotype 06/23/2014
82 280532 APN Abcb11 0.691 IGL02119 2 69328000 T A critical splice acceptor site Het probably null phenotype 04/16/2015
83 49312 UTSW Abcb1b 0.398 R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably null 0.949 phenotype 06/12/2013
84 314451 UTSW Abcb4 0.000 R4112 G1 225 Y 5 8936783 A G critical splice acceptor site Het probably null 0.949 phenotype 05/14/2015
85 346036 UTSW Abcb5 0.213 R4606 G1 225 Y 12 118932610 T C critical splice acceptor site Het probably null 0.948 phenotype 09/25/2015
86 521932 UTSW Abcb6 0.232 R6527 G1 225.01 N 1 75177488 T C critical splice acceptor site Het probably null phenotype 06/06/2018
87 261898 UTSW Abcb9 0.000 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably null 0.950 phenotype 02/04/2015
88 275295 UTSW Abcc3 0.000 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably null 0.949 phenotype 04/02/2015
89 448782 UTSW Abcc9 0.124 R5802 G1 225 Y 6 142656676 C A critical splice acceptor site Het probably null 0.948 phenotype 12/15/2016
90 640808 UTSW Abcc9 0.124 R8245 G1 225.01 Y 6 142594144 T A critical splice acceptor site Het probably null phenotype 07/28/2020
91 283488 APN Abcd2 0.121 IGL02084 15 91178327 T A critical splice acceptor site Het probably null phenotype 04/16/2015
92 22524 UTSW Abcd4 0.276 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably null 0.951 phenotype 04/16/2013
93 416821 APN Abcf2 0.279 IGL03329 5 24571248 T G critical splice acceptor site Het probably null phenotype 08/02/2016
94 214910 UTSW Abcg8 0.000 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably null 0.947 phenotype 07/14/2014
95 58394 UTSW Abhd12 0.260 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably null 0.947 phenotype 07/11/2013
96 316602 UTSW Abhd12 0.260 R4077 G1 225 Y 2 150848459 T A critical splice acceptor site Het probably null 0.949 phenotype 05/15/2015
97 664552 UTSW Abhd12b 0.060 R8773 G1 128.01 N 12 70166934 A C critical splice acceptor site Het probably null 03/08/2021
98 76737 UTSW Abi3bp 0.090 R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably null 0.867 10/16/2013
99 650815 UTSW Ablim1 0.443 R7974 G1 225.01 Y 19 57044973 C T critical splice acceptor site Het probably null phenotype 09/15/2020
100 61397 UTSW Abraxas2 0.000 R0670 G1 113 N 7 132869031 A T critical splice acceptor site Het probably null 07/30/2013
[records 1 to 100 of 2997] next >> last >|