Incidental Mutations

1,876 incidental mutations are currently displayed, and affect 1,501 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
149 are Probably Benign.
1,715 are Probably Null.
4 create premature stop codons.
1,876 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1876] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 192678 UTSW 1110017D15Rik 0.066 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.542 phenotype 05/23/2014
2 192500 UTSW 1700001C02Rik 0.222 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
3 243413 UTSW 1700001C19Rik 0.020 R2256 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 10/16/2014
4 243483 UTSW 1700001C19Rik 0.020 R2257 G1 204 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 10/16/2014
5 273682 UTSW 1700001C19Rik 0.020 R3498 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/02/2015
6 273727 UTSW 1700001C19Rik 0.020 R3499 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/02/2015
7 275564 UTSW 1700001C19Rik 0.020 R3834 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/06/2015
8 275608 UTSW 1700001C19Rik 0.020 R3835 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/06/2015
9 308997 UTSW 1700001C19Rik 0.020 R3901 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
10 309355 UTSW 1700001C19Rik 0.020 R3910 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
11 309425 UTSW 1700001C19Rik 0.020 R3911 G1 215 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
12 309536 UTSW 1700001C19Rik 0.020 R3913 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
13 538049 UTSW 1700011H14Rik 0.058 R6841 G1 225.01 N 14 49243813 T C critical splice acceptor site Het probably null 10/18/2018
14 388197 UTSW 1700017D01Rik 0.068 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.650 06/06/2016
15 478683 UTSW 1700019A02Rik 0.137 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
16 190952 UTSW 1700023F06Rik 0.033 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
17 409841 APN 1700029H14Rik 0.026 IGL03069 8 13557704 T G critical splice acceptor site Het probably null 08/02/2016
18 39342 UTSW 1700067P10Rik 0.017 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.600 05/23/2013
19 379571 UTSW 2010111I01Rik 0.190 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.492 phenotype 04/15/2016
20 26543 UTSW 2010315B03Rik 0.127 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
21 60600 UTSW 2010315B03Rik 0.127 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
22 60571 UTSW 2010315B03Rik 0.127 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
23 22264 UTSW 2010315B03Rik 0.127 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
24 500098 UTSW 2010315B03Rik 0.127 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
25 31421 UTSW 2010315B03Rik 0.127 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
26 76984 UTSW 2010315B03Rik 0.127 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
27 76493 UTSW 2010315B03Rik 0.127 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
28 406142 UTSW 2310022A10Rik 0.151 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.486 07/28/2016
29 208042 UTSW 4430402I18Rik 0.093 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.486 06/23/2014
30 462735 UTSW 4833423E24Rik 0.079 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.644 03/01/2017
31 382658 UTSW 4921507P07Rik 0.113 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
32 318775 UTSW 4921524L21Rik 0.096 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
33 370200 UTSW 4930430A15Rik 0.041 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.476 02/04/2016
34 507928 UTSW 4930452B06Rik 0.107 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably null 03/15/2018
35 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
36 482208 UTSW 4930579C12Rik 0.150 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
37 511096 UTSW 4932438A13Rik 0.857 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
38 511596 UTSW 4932438A13Rik 0.857 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
39 212811 UTSW 4932438A13Rik 0.857 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
40 532627 UTSW 4932438A13Rik 0.857 R6792 G1 225.01 N 3 37011566 A G critical splice acceptor site Het probably null phenotype 08/29/2018
41 57694 UTSW 5430403G16Rik 0.125 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 0.520 07/11/2013
42 241496 UTSW 5430419D17Rik 0.041 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
43 241616 UTSW 5430419D17Rik 0.041 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
44 249756 UTSW 5830473C10Rik 0.280 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
45 376254 UTSW 9930111J21Rik1 0.149 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
46 436215 UTSW A2ml1 0.263 R5532 G1 225 N 6 128553330 T A critical splice acceptor site Het probably null 10/24/2016
47 166432 UTSW A430105I19Rik 0.059 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
48 391994 UTSW A530016L24Rik 0.012 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 0.644 06/08/2016
49 345326 UTSW A830018L16Rik 0.137 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably null phenotype 09/25/2015
50 479514 UTSW A830018L16Rik 0.137 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably null 0.522 phenotype 06/26/2017
51 102103 UTSW Aak1 0.288 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null phenotype 01/15/2014
52 479868 UTSW Aanat 0.061 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably null 0.458 phenotype 06/26/2017
53 204589 UTSW Aass 0.421 R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null phenotype 06/23/2014
54 489401 UTSW Abca13 0.148 R6153 G1 225.01 Y 11 9301259 G T critical splice acceptor site Het probably null 0.480 phenotype 10/10/2017
55 349067 UTSW Abca6 0.094 R4629 G1 225 N 11 110230549 T C critical splice acceptor site Het probably null phenotype 10/08/2015
56 217018 UTSW Abca8a 0.084 R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
57 486155 UTSW Abca8a 0.084 R6090 G1 225.01 N 11 110063222 T C critical splice acceptor site Het probably null 08/16/2017
58 204725 UTSW Abca8b 0.350 R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably null 0.448 phenotype 06/23/2014
59 280532 APN Abcb11 0.000 IGL02119 2 69328000 T A critical splice acceptor site Het probably null phenotype 04/16/2015
60 49312 UTSW Abcb1b 0.343 R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably null 0.598 phenotype 06/12/2013
61 314451 UTSW Abcb4 0.000 R4112 G1 225 Y 5 8936783 A G critical splice acceptor site Het probably null 0.550 phenotype 05/14/2015
62 346036 UTSW Abcb5 0.296 R4606 G1 225 Y 12 118932610 T C critical splice acceptor site Het probably null 0.582 phenotype 09/25/2015
63 521932 UTSW Abcb6 0.739 R6527 G1 225.01 N 1 75177488 T C critical splice acceptor site Het probably null phenotype 06/06/2018
64 261898 UTSW Abcb9 0.194 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably null 0.568 phenotype 02/04/2015
65 275295 UTSW Abcc3 0.231 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably null 0.564 phenotype 04/02/2015
66 448782 UTSW Abcc9 0.276 R5802 G1 225 Y 6 142656676 C A critical splice acceptor site Het probably null 0.568 phenotype 12/15/2016
67 22524 UTSW Abcd4 0.435 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably null 0.572 phenotype 04/16/2013
68 214910 UTSW Abcg8 0.000 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably null 0.470 phenotype 07/14/2014
69 58394 UTSW Abhd12 0.386 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably null 0.452 phenotype 07/11/2013
70 316602 UTSW Abhd12 0.386 R4077 G1 225 Y 2 150848459 T A critical splice acceptor site Het probably null 0.536 phenotype 05/15/2015
71 76737 UTSW Abi3bp 0.163 R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably null 0.454 10/16/2013
72 61397 UTSW Abraxas2 0.315 R0670 G1 113 N 7 132869031 A T critical splice acceptor site Het probably null 07/30/2013
73 440160 UTSW Abtb2 0.243 R5513 G1 203 Y 2 103709278 A T critical splice acceptor site Het probably null 0.466 11/08/2016
74 266910 UTSW Acaa1a 0.280 R3418 G1 225 Y 9 119349490 A G critical splice acceptor site Het probably null 0.564 phenotype 02/18/2015
75 48328 UTSW Acaca 1.000 R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably null phenotype 06/12/2013
76 524617 UTSW Acaca 1.000 R6623 G1 225.01 N 11 84371499 A C critical splice acceptor site Het probably null phenotype 06/22/2018
77 326220 UTSW Acacb 0.000 R4386 G1 207 Y 5 114241921 A T critical splice acceptor site Het probably null 0.580 phenotype 07/06/2015
78 183777 APN Acad9 0.869 IGL02016 G1 3 36088486 A T critical splice acceptor site Het probably null phenotype 05/07/2014
79 389143 UTSW Acadsb 0.149 R5020 G1 225 Y 7 131441200 A T critical splice acceptor site Het probably null 0.542 phenotype 06/06/2016
80 484254 UTSW Acap1 0.000 R6053 G1 225.01 N 11 69887070 T G critical splice acceptor site Het probably null 07/14/2017
81 330387 UTSW Accsl 0.073 R4472 G1 225 Y 2 93863991 T A critical splice acceptor site Het probably null 0.486 07/21/2015
82 209805 UTSW Aco1 0.519 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null 0.500 phenotype 06/30/2014
83 523065 UTSW Acsm3 0.000 R6497 G1 225.01 Y 7 119780749 G A critical splice acceptor site Het probably null phenotype 06/06/2018
84 157015 UTSW Actn1 0.472 R1340 G1 224 Y 12 80173144 T C critical splice acceptor site Het probably null 0.566 phenotype 02/11/2014
85 402748 UTSW Actn2 0.650 R5228 G1 225 N 13 12288659 T C critical splice acceptor site Het probably null phenotype 07/22/2016
86 462619 UTSW Actn3 0.000 R5753 G1 225 Y 19 4864567 T C critical splice acceptor site Het probably null 0.508 phenotype 03/01/2017
87 43485 UTSW Adam32 0.166 R0189 G1 154 Y 8 24922337 T A critical splice acceptor site Het probably null 0.464 phenotype 05/24/2013
88 527180 UTSW Adam7 0.076 R6672 G1 225.01 N 14 68504702 T A critical splice acceptor site Het probably null phenotype 07/23/2018
89 538409 UTSW Adamts2 0.179 R6897 G1 225.01 N 11 50737164 A T critical splice acceptor site Het probably null phenotype 11/06/2018
90 36286 UTSW Adamts6 0.780 R0362 G1 214 Y 13 104390076 A G critical splice acceptor site Het probably null 0.530 phenotype 05/09/2013
91 427459 UTSW Adamtsl1 0.207 R5411 G1 225 N 4 86388413 G A critical splice acceptor site Het probably null phenotype 09/01/2016
92 42073 UTSW Adcy4 0.000 R0482 G1 225 Y 14 55774572 T A critical splice acceptor site Het probably null 0.526 phenotype 05/23/2013
93 537769 UTSW Adcy8 0.212 R6823 G1 225.01 N 15 64754886 T G critical splice acceptor site Het probably null phenotype 10/18/2018
94 435084 UTSW Adgrb2 0.000 R5550 G1 225 N 4 130014934 G T critical splice acceptor site Het probably null phenotype 10/24/2016
95 357788 UTSW Adgrf3 0.111 R4754 G1 225 Y 5 30197617 T A critical splice acceptor site Het probably null 0.472 11/11/2015
96 1004 APN Adgrv1 0.000 IGL00090 G1 13 81405408 T G critical splice acceptor site Het probably null phenotype 07/12/2011
97 168020 UTSW Adgrv1 0.000 R1507 G1 225 Y 13 81472580 T C critical splice acceptor site Het probably null 0.452 phenotype 04/13/2014
98 200922 UTSW Adh1 0.000 R1464 G1 225 N 3 138288747 A G critical splice acceptor site Het probably null phenotype 05/23/2014
99 383896 UTSW Agfg2 0.143 R4965 G1 225 N 5 137667177 C A critical splice acceptor site Het probably null phenotype 04/27/2016
100 231044 UTSW Ago1 0.540 R2117 G1 225 N 4 126463857 T A critical splice acceptor site Het probably null phenotype 09/18/2014
[records 1 to 100 of 1876] next >> last >|