Incidental Mutations

2,375 incidental mutations are currently displayed, and affect 1,893 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
141 are Probably Benign.
2,220 are Probably Null.
0 create premature stop codons.
2,375 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 2375] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 192678 UTSW 1110017D15Rik 0.000 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.542 phenotype 05/23/2014
2 192500 UTSW 1700001C02Rik 0.000 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
3 538049 UTSW 1700011H14Rik 0.058 R6841 G1 225.01 Y 14 49243813 T C critical splice acceptor site Het probably null 10/18/2018
4 388197 UTSW 1700017D01Rik 0.079 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.650 06/06/2016
5 478683 UTSW 1700019A02Rik 0.133 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
6 190952 UTSW 1700023F06Rik 0.052 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
7 409841 APN 1700029H14Rik 0.000 IGL03069 8 13557704 T G critical splice acceptor site Het probably null 08/02/2016
8 39342 UTSW 1700067P10Rik 0.057 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.600 05/23/2013
9 379571 UTSW 2010111I01Rik 0.111 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.492 phenotype 04/15/2016
10 26543 UTSW 2010315B03Rik 0.068 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
11 60600 UTSW 2010315B03Rik 0.068 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
12 60571 UTSW 2010315B03Rik 0.068 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
13 22264 UTSW 2010315B03Rik 0.068 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
14 500098 UTSW 2010315B03Rik 0.068 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
15 31421 UTSW 2010315B03Rik 0.068 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
16 76984 UTSW 2010315B03Rik 0.068 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
17 76493 UTSW 2010315B03Rik 0.068 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
18 89620 APN 2300002M23Rik 0.107 IGL01527 G1 17 35567833 G T critical splice acceptor site Het probably null phenotype 12/03/2013
19 406142 UTSW 2310022A10Rik 0.206 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.486 07/28/2016
20 559734 UTSW 2700049A03Rik 1.000 R7193 G1 225.01 Y 12 71219189 A G critical splice acceptor site Het probably null phenotype 06/26/2019
21 180063 APN 2700062C07Rik 0.854 IGL01919 G1 18 24475523 A G critical splice acceptor site Het probably null 05/07/2014
22 208042 UTSW 4430402I18Rik 0.080 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.486 06/23/2014
23 462735 UTSW 4833423E24Rik 0.093 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.644 03/01/2017
24 278029 APN 4921507P07Rik 0.059 IGL00852 G1 6 50589184 T A critical splice acceptor site Het probably null 04/16/2015
25 382658 UTSW 4921507P07Rik 0.059 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
26 318775 UTSW 4921524L21Rik 0.077 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
27 370200 UTSW 4930430A15Rik 0.057 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.476 02/04/2016
28 507928 UTSW 4930452B06Rik 0.069 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably null 0.550 03/15/2018
29 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
30 482208 UTSW 4930579C12Rik 0.074 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
31 511096 UTSW 4932438A13Rik 1.000 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
32 511596 UTSW 4932438A13Rik 1.000 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
33 53494 APN 4932438A13Rik 1.000 IGL01019 G1 3 37006984 G T critical splice acceptor site Het probably null phenotype 06/28/2013
34 212811 UTSW 4932438A13Rik 1.000 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
35 532627 UTSW 4932438A13Rik 1.000 R6792 G1 225.01 Y 3 37011566 A G critical splice acceptor site Het probably null phenotype 08/29/2018
36 57694 UTSW 5430403G16Rik 0.065 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 0.520 07/11/2013
37 241496 UTSW 5430419D17Rik 0.000 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
38 241616 UTSW 5430419D17Rik 0.000 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
39 249756 UTSW 5830473C10Rik 0.064 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
40 376254 UTSW 9930111J21Rik1 0.072 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
41 420239 APN A2m 0.000 IGL03369 6 121676903 G A critical splice acceptor site Het probably null phenotype 08/02/2016
42 436215 UTSW A2ml1 0.000 R5532 G1 225 N 6 128553330 T A critical splice acceptor site Het probably null 10/24/2016
43 166432 UTSW A430105I19Rik 0.000 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
44 565276 UTSW A430105I19Rik 0.000 R7271 G1 225.01 Y 2 118760683 T A critical splice acceptor site Het probably null 0.610 06/26/2019
45 391994 UTSW A530016L24Rik 0.017 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 0.644 06/08/2016
46 564038 UTSW A730017C20Rik 0.000 R7252 G1 225.01 Y 18 59066908 A G critical splice acceptor site Het probably null 06/26/2019
47 345326 UTSW A830018L16Rik 0.065 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably null phenotype 09/25/2015
48 479514 UTSW A830018L16Rik 0.065 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably null 0.522 phenotype 06/26/2017
49 302040 APN Aadacl4 0.063 IGL02648 4 144617822 A T critical splice acceptor site Het probably null 04/16/2015
50 102103 UTSW Aak1 0.433 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null phenotype 01/15/2014
51 479868 UTSW Aanat 0.067 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably null 0.458 phenotype 06/26/2017
52 204589 UTSW Aass 0.000 R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null phenotype 06/23/2014
53 12430 APN Abca12 1.000 IGL00813 G1 1 71353762 C A critical splice acceptor site Het probably null phenotype 12/06/2012
54 489401 UTSW Abca13 0.000 R6153 G1 225.01 Y 11 9301259 G T critical splice acceptor site Het probably null 0.480 phenotype 10/10/2017
55 4474 APN Abca5 0.270 IGL00487 G1 11 110309450 T A critical splice acceptor site Het probably null phenotype 04/20/2012
56 349067 UTSW Abca6 0.000 R4629 G1 225 N 11 110230549 T C critical splice acceptor site Het probably null phenotype 10/08/2015
57 217018 UTSW Abca8a 0.085 R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
58 486155 UTSW Abca8a 0.085 R6090 G1 225.01 N 11 110063222 T C critical splice acceptor site Het probably null 08/16/2017
59 204725 UTSW Abca8b 0.000 R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably null 0.448 phenotype 06/23/2014
60 280532 APN Abcb11 0.324 IGL02119 2 69328000 T A critical splice acceptor site Het probably null phenotype 04/16/2015
61 49312 UTSW Abcb1b 0.383 R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably null 0.598 phenotype 06/12/2013
62 314451 UTSW Abcb4 0.000 R4112 G1 225 Y 5 8936783 A G critical splice acceptor site Het probably null 0.550 phenotype 05/14/2015
63 346036 UTSW Abcb5 0.191 R4606 G1 225 Y 12 118932610 T C critical splice acceptor site Het probably null 0.582 phenotype 09/25/2015
64 521932 UTSW Abcb6 0.240 R6527 G1 225.01 N 1 75177488 T C critical splice acceptor site Het probably null phenotype 06/06/2018
65 261898 UTSW Abcb9 0.000 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably null 0.568 phenotype 02/04/2015
66 275295 UTSW Abcc3 0.000 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably null 0.564 phenotype 04/02/2015
67 448782 UTSW Abcc9 0.114 R5802 G1 225 Y 6 142656676 C A critical splice acceptor site Het probably null 0.568 phenotype 12/15/2016
68 283488 APN Abcd2 0.105 IGL02084 15 91178327 T A critical splice acceptor site Het probably null phenotype 04/16/2015
69 22524 UTSW Abcd4 0.180 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably null 0.572 phenotype 04/16/2013
70 416821 APN Abcf2 0.232 IGL03329 5 24571248 T G critical splice acceptor site Het probably null phenotype 08/02/2016
71 214910 UTSW Abcg8 0.000 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably null 0.470 phenotype 07/14/2014
72 58394 UTSW Abhd12 0.129 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably null 0.452 phenotype 07/11/2013
73 316602 UTSW Abhd12 0.129 R4077 G1 225 Y 2 150848459 T A critical splice acceptor site Het probably null 0.536 phenotype 05/15/2015
74 76737 UTSW Abi3bp 0.088 R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably null 0.454 10/16/2013
75 61397 UTSW Abraxas2 0.000 R0670 G1 113 N 7 132869031 A T critical splice acceptor site Het probably null 07/30/2013
76 440160 UTSW Abtb2 0.000 R5513 G1 203 Y 2 103709278 A T critical splice acceptor site Het probably null 0.466 11/08/2016
77 266910 UTSW Acaa1a 0.000 R3418 G1 225 Y 9 119349490 A G critical splice acceptor site Het probably null 0.564 phenotype 02/18/2015
78 48328 UTSW Acaca 1.000 R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably null phenotype 06/12/2013
79 524617 UTSW Acaca 1.000 R6623 G1 225.01 Y 11 84371499 A C critical splice acceptor site Het probably null phenotype 06/22/2018
80 326220 UTSW Acacb 0.000 R4386 G1 207 Y 5 114241921 A T critical splice acceptor site Het probably null 0.580 phenotype 07/06/2015
81 564130 UTSW Acacb 0.000 R7254 G1 225.01 Y 5 114209751 A C critical splice acceptor site Het probably null phenotype 06/26/2019
82 183777 APN Acad9 0.912 IGL02016 G1 3 36088486 A T critical splice acceptor site Het probably null phenotype 05/07/2014
83 389143 UTSW Acadsb 0.000 R5020 G1 225 Y 7 131441200 A T critical splice acceptor site Het probably null 0.542 phenotype 06/06/2016
84 484254 UTSW Acap1 0.000 R6053 G1 225.01 N 11 69887070 T G critical splice acceptor site Het probably null 07/14/2017
85 330387 UTSW Accsl 0.076 R4472 G1 225 Y 2 93863991 T A critical splice acceptor site Het probably null 0.486 07/21/2015
86 209805 UTSW Aco1 0.458 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null 0.500 phenotype 06/30/2014
87 523065 UTSW Acsm3 0.000 R6497 G1 225.01 Y 7 119780749 G A critical splice acceptor site Het probably null 0.458 phenotype 06/06/2018
88 157015 UTSW Actn1 0.455 R1340 G1 224 Y 12 80173144 T C critical splice acceptor site Het probably null 0.566 phenotype 02/11/2014
89 402748 UTSW Actn2 0.615 R5228 G1 225 N 13 12288659 T C critical splice acceptor site Het probably null phenotype 07/22/2016
90 462619 UTSW Actn3 0.486 R5753 G1 225 Y 19 4864567 T C critical splice acceptor site Het probably null 0.508 phenotype 03/01/2017
91 554398 UTSW Adam15 0.358 PIT4280001 G1 225.01 N 3 89343978 C T critical splice acceptor site Het probably null phenotype 06/07/2019
92 43485 UTSW Adam32 0.000 R0189 G1 154 Y 8 24922337 T A critical splice acceptor site Het probably null 0.464 phenotype 05/24/2013
93 527180 UTSW Adam7 0.058 R6672 G1 225.01 Y 14 68504702 T A critical splice acceptor site Het probably null 0.580 phenotype 07/23/2018
94 544235 UTSW Adamts16 0.000 R6996 G1 225.01 N 13 70798038 C T critical splice acceptor site Het probably null phenotype 05/13/2019
95 538409 UTSW Adamts2 0.114 R6897 G1 225.01 Y 11 50737164 A T critical splice acceptor site Het probably null phenotype 11/06/2018
96 574158 UTSW Adamts3 1.000 R7401 G1 225.01 N 5 89707450 T A critical splice acceptor site Het probably null phenotype 09/13/2019
97 36286 UTSW Adamts6 0.854 R0362 G1 214 Y 13 104390076 A G critical splice acceptor site Het probably null 0.530 phenotype 05/09/2013
98 427459 UTSW Adamtsl1 0.122 R5411 G1 225 N 4 86388413 G A critical splice acceptor site Het probably null phenotype 09/01/2016
99 289550 APN Adamtsl5 0.000 IGL02352 10 80343728 T A critical splice acceptor site Het probably null 04/16/2015
100 290442 APN Adamtsl5 0.000 IGL02359 10 80343728 T A critical splice acceptor site Het probably null 04/16/2015
[records 1 to 100 of 2375] next >> last >|