Incidental Mutations

1,847 incidental mutations are currently displayed, and affect 1,476 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
148 are Probably Benign.
1,687 are Probably Null.
4 create premature stop codons.
1,847 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1847] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 192678 UTSW 1110017D15Rik 0.066 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.542 phenotype 05/23/2014
2 192500 UTSW 1700001C02Rik 0.222 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
3 243413 UTSW 1700001C19Rik 0.020 R2256 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 10/16/2014
4 243483 UTSW 1700001C19Rik 0.020 R2257 G1 204 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 10/16/2014
5 273682 UTSW 1700001C19Rik 0.020 R3498 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/02/2015
6 273727 UTSW 1700001C19Rik 0.020 R3499 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/02/2015
7 275564 UTSW 1700001C19Rik 0.020 R3834 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/06/2015
8 275608 UTSW 1700001C19Rik 0.020 R3835 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/06/2015
9 308997 UTSW 1700001C19Rik 0.020 R3901 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
10 309355 UTSW 1700001C19Rik 0.020 R3910 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
11 309425 UTSW 1700001C19Rik 0.020 R3911 G1 215 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
12 309536 UTSW 1700001C19Rik 0.020 R3913 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
13 388197 UTSW 1700017D01Rik 0.068 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.650 06/06/2016
14 478683 UTSW 1700019A02Rik 0.137 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
15 190952 UTSW 1700023F06Rik 0.033 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
16 409841 APN 1700029H14Rik 0.026 IGL03069 8 13557704 T G critical splice acceptor site Het probably null 08/02/2016
17 39342 UTSW 1700067P10Rik 0.017 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.600 05/23/2013
18 379571 UTSW 2010111I01Rik 0.190 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.492 phenotype 04/15/2016
19 26543 UTSW 2010315B03Rik 0.127 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
20 60600 UTSW 2010315B03Rik 0.127 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
21 60571 UTSW 2010315B03Rik 0.127 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
22 22264 UTSW 2010315B03Rik 0.127 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
23 500098 UTSW 2010315B03Rik 0.127 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
24 31421 UTSW 2010315B03Rik 0.127 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
25 76984 UTSW 2010315B03Rik 0.127 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
26 76493 UTSW 2010315B03Rik 0.127 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
27 406142 UTSW 2310022A10Rik 0.151 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.486 07/28/2016
28 208042 UTSW 4430402I18Rik 0.093 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.486 06/23/2014
29 462735 UTSW 4833423E24Rik 0.079 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.644 03/01/2017
30 382658 UTSW 4921507P07Rik 0.113 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
31 318775 UTSW 4921524L21Rik 0.096 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
32 370200 UTSW 4930430A15Rik 0.041 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.476 02/04/2016
33 507928 UTSW 4930452B06Rik 0.104 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably null 03/15/2018
34 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
35 482208 UTSW 4930579C12Rik 0.150 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
36 511096 UTSW 4932438A13Rik 0.921 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
37 511596 UTSW 4932438A13Rik 0.921 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
38 212811 UTSW 4932438A13Rik 0.921 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
39 532627 UTSW 4932438A13Rik 0.921 R6792 G1 225.01 N 3 37011566 A G critical splice acceptor site Het probably null phenotype 08/29/2018
40 57694 UTSW 5430403G16Rik 0.125 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 0.520 07/11/2013
41 241496 UTSW 5430419D17Rik 0.132 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
42 241616 UTSW 5430419D17Rik 0.132 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
43 249756 UTSW 5830473C10Rik 0.280 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
44 376254 UTSW 9930111J21Rik1 0.149 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
45 436215 UTSW A2ml1 0.263 R5532 G1 225 N 6 128553330 T A critical splice acceptor site Het probably null 10/24/2016
46 166432 UTSW A430105I19Rik 0.059 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
47 391994 UTSW A530016L24Rik 0.012 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 0.644 06/08/2016
48 345326 UTSW A830018L16Rik 0.137 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably null phenotype 09/25/2015
49 479514 UTSW A830018L16Rik 0.137 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably null 0.522 phenotype 06/26/2017
50 102103 UTSW Aak1 0.288 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null phenotype 01/15/2014
51 479868 UTSW Aanat 0.061 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably null 0.458 phenotype 06/26/2017
52 204589 UTSW Aass 0.421 R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null phenotype 06/23/2014
53 489401 UTSW Abca13 0.148 R6153 G1 225.01 Y 11 9301259 G T critical splice acceptor site Het probably null 0.480 phenotype 10/10/2017
54 349067 UTSW Abca6 0.094 R4629 G1 225 N 11 110230549 T C critical splice acceptor site Het probably null phenotype 10/08/2015
55 217018 UTSW Abca8a 0.122 R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
56 486155 UTSW Abca8a 0.122 R6090 G1 225.01 N 11 110063222 T C critical splice acceptor site Het probably null 08/16/2017
57 204725 UTSW Abca8b 0.350 R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably null 0.448 phenotype 06/23/2014
58 280532 APN Abcb11 0.000 IGL02119 2 69328000 T A critical splice acceptor site Het probably null phenotype 04/16/2015
59 49312 UTSW Abcb1b 0.343 R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably null 0.598 phenotype 06/12/2013
60 314451 UTSW Abcb4 0.000 R4112 G1 225 Y 5 8936783 A G critical splice acceptor site Het probably null 0.550 phenotype 05/14/2015
61 346036 UTSW Abcb5 0.298 R4606 G1 225 Y 12 118932610 T C critical splice acceptor site Het probably null 0.582 phenotype 09/25/2015
62 521932 UTSW Abcb6 0.739 R6527 G1 225.01 N 1 75177488 T C critical splice acceptor site Het probably null phenotype 06/06/2018
63 261898 UTSW Abcb9 0.194 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably null 0.568 phenotype 02/04/2015
64 275295 UTSW Abcc3 0.231 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably null 0.564 phenotype 04/02/2015
65 448782 UTSW Abcc9 0.276 R5802 G1 225 Y 6 142656676 C A critical splice acceptor site Het probably null 0.568 phenotype 12/15/2016
66 22524 UTSW Abcd4 0.435 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably null 0.572 phenotype 04/16/2013
67 214910 UTSW Abcg8 0.000 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably null 0.470 phenotype 07/14/2014
68 58394 UTSW Abhd12 0.386 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably null 0.452 phenotype 07/11/2013
69 316602 UTSW Abhd12 0.386 R4077 G1 225 Y 2 150848459 T A critical splice acceptor site Het probably null 0.536 phenotype 05/15/2015
70 76737 UTSW Abi3bp 0.163 R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably null 0.454 10/16/2013
71 61397 UTSW Abraxas2 0.315 R0670 G1 113 N 7 132869031 A T critical splice acceptor site Het probably null 07/30/2013
72 440160 UTSW Abtb2 0.243 R5513 G1 203 Y 2 103709278 A T critical splice acceptor site Het probably null 0.466 11/08/2016
73 266910 UTSW Acaa1a 0.545 R3418 G1 225 Y 9 119349490 A G critical splice acceptor site Het probably null 0.564 phenotype 02/18/2015
74 48328 UTSW Acaca 1.000 R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably null phenotype 06/12/2013
75 524617 UTSW Acaca 1.000 R6623 G1 225.01 N 11 84371499 A C critical splice acceptor site Het probably null phenotype 06/22/2018
76 326220 UTSW Acacb 0.000 R4386 G1 207 Y 5 114241921 A T critical splice acceptor site Het probably null 0.580 phenotype 07/06/2015
77 183777 APN Acad9 0.869 IGL02016 G1 3 36088486 A T critical splice acceptor site Het probably null phenotype 05/07/2014
78 389143 UTSW Acadsb 0.148 R5020 G1 225 Y 7 131441200 A T critical splice acceptor site Het probably null 0.542 phenotype 06/06/2016
79 484254 UTSW Acap1 0.000 R6053 G1 225.01 N 11 69887070 T G critical splice acceptor site Het probably null 07/14/2017
80 330387 UTSW Accsl 0.073 R4472 G1 225 Y 2 93863991 T A critical splice acceptor site Het probably null 0.486 07/21/2015
81 209805 UTSW Aco1 0.512 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null 0.500 phenotype 06/30/2014
82 523065 UTSW Acsm3 0.000 R6497 G1 225.01 N 7 119780749 G A critical splice acceptor site Het probably null phenotype 06/06/2018
83 157015 UTSW Actn1 0.472 R1340 G1 224 Y 12 80173144 T C critical splice acceptor site Het probably null 0.566 phenotype 02/11/2014
84 402748 UTSW Actn2 0.650 R5228 G1 225 N 13 12288659 T C critical splice acceptor site Het probably null phenotype 07/22/2016
85 462619 UTSW Actn3 0.000 R5753 G1 225 Y 19 4864567 T C critical splice acceptor site Het probably null 0.508 phenotype 03/01/2017
86 43485 UTSW Adam32 0.166 R0189 G1 154 Y 8 24922337 T A critical splice acceptor site Het probably null 0.464 phenotype 05/24/2013
87 527180 UTSW Adam7 0.076 R6672 G1 225.01 N 14 68504702 T A critical splice acceptor site Het probably null phenotype 07/23/2018
88 36286 UTSW Adamts6 0.780 R0362 G1 214 Y 13 104390076 A G critical splice acceptor site Het probably null 0.530 phenotype 05/09/2013
89 427459 UTSW Adamtsl1 0.207 R5411 G1 225 N 4 86388413 G A critical splice acceptor site Het probably null phenotype 09/01/2016
90 42073 UTSW Adcy4 0.000 R0482 G1 225 Y 14 55774572 T A critical splice acceptor site Het probably null 0.526 phenotype 05/23/2013
91 435084 UTSW Adgrb2 0.000 R5550 G1 225 N 4 130014934 G T critical splice acceptor site Het probably null phenotype 10/24/2016
92 357788 UTSW Adgrf3 0.111 R4754 G1 225 Y 5 30197617 T A critical splice acceptor site Het probably null 0.472 11/11/2015
93 1004 APN Adgrv1 0.000 IGL00090 G1 13 81405408 T G critical splice acceptor site Het probably null phenotype 07/12/2011
94 168020 UTSW Adgrv1 0.000 R1507 G1 225 Y 13 81472580 T C critical splice acceptor site Het probably null 0.452 phenotype 04/13/2014
95 200922 UTSW Adh1 0.000 R1464 G1 225 N 3 138288747 A G critical splice acceptor site Het probably null phenotype 05/23/2014
96 383896 UTSW Agfg2 0.143 R4965 G1 225 N 5 137667177 C A critical splice acceptor site Het probably null phenotype 04/27/2016
97 231044 UTSW Ago1 0.540 R2117 G1 225 N 4 126463857 T A critical splice acceptor site Het probably null phenotype 09/18/2014
98 449014 UTSW Ago2 1.000 R5815 G1 225 N 15 73107366 T C critical splice acceptor site Het probably null phenotype 12/20/2016
99 169062 UTSW Agr3 0.063 R1498 G1 225 Y 12 35934380 A T critical splice acceptor site Het probably null 0.594 phenotype 04/13/2014
100 401408 UTSW Aif1 0.267 R5260 G1 225 Y 17 35171941 T A critical splice acceptor site Het probably null 0.646 phenotype 07/06/2016
[records 1 to 100 of 1847] next >> last >|