Mutagenetix > Incidental Mutation

Incidental Mutation 'R0813:Neu4'

78543

Institutional Source

Beutler Lab

Gene Symbol

Neu4

Ensembl Gene

ENSMUSG00000034000

Gene Name

sialidase 4

Synonyms

MMRRC Submission

038993-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0813 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

93948215-93956056 bp(+) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

AG to A at 93950598 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050890] [ENSMUST00000190212]

AlphaFold

Q8BZL1

Predicted Effect

probably null
Transcript: ENSMUST00000050890

SMART Domains

Protein: ENSMUSP00000051151
Gene: ENSMUSG00000034000

Domain	Start	End	E-Value	Type
Pfam:BNR_3	24	256	5.8e-10	PFAM
Pfam:BNR_2	34	270	2e-29	PFAM
SCOP:d3sil__	371	448	4e-12	SMART
PDB:2F13\|A	371	455	8e-12	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000190212

SMART Domains

Protein: ENSMUSP00000140127
Gene: ENSMUSG00000034000

Domain	Start	End	E-Value	Type
Pfam:BNR_3	47	279	1.6e-6	PFAM
Pfam:BNR_2	58	304	4.6e-25	PFAM
SCOP:d3sil__	394	471	4e-12	SMART
PDB:2F29\|B	394	478	1e-11	PDB

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of glycohydrolytic enzymes, which remove terminal sialic acid residues from various sialo derivatives, such as glycoproteins, glycolipids, oligosaccharides, and gangliosides. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele are largely normal except increased lipid content in the lung and liver and vacuolization indicative of lysosomal storage disorder. [provided by MGI curators]

Allele List at MGI

Other mutations in Neu4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02367:Neu4	APN	1	93,952,213 (GRCm39)	missense	probably damaging	1.00
IGL03348:Neu4	APN	1	93,952,696 (GRCm39)	missense	possibly damaging	0.77
R0018:Neu4	UTSW	1	93,953,060 (GRCm39)	missense	probably benign	0.00
R0018:Neu4	UTSW	1	93,953,060 (GRCm39)	missense	probably benign	0.00
R0645:Neu4	UTSW	1	93,950,191 (GRCm39)	missense	probably damaging	1.00
R0814:Neu4	UTSW	1	93,950,598 (GRCm39)	frame shift	probably null
R2056:Neu4	UTSW	1	93,950,172 (GRCm39)	missense	possibly damaging	0.77
R4354:Neu4	UTSW	1	93,952,279 (GRCm39)	missense	probably damaging	1.00
R4922:Neu4	UTSW	1	93,950,200 (GRCm39)	missense	probably damaging	0.98
R5156:Neu4	UTSW	1	93,952,177 (GRCm39)	missense	probably damaging	1.00
R5268:Neu4	UTSW	1	93,952,669 (GRCm39)	missense	probably benign	0.18
R5447:Neu4	UTSW	1	93,950,140 (GRCm39)	missense	probably damaging	1.00
R5862:Neu4	UTSW	1	93,950,652 (GRCm39)	missense	probably benign	0.20
R6280:Neu4	UTSW	1	93,952,873 (GRCm39)	missense	probably damaging	1.00
R6697:Neu4	UTSW	1	93,952,752 (GRCm39)	missense	probably benign	0.00
R7192:Neu4	UTSW	1	93,952,863 (GRCm39)	missense	probably benign	0.01
R7533:Neu4	UTSW	1	93,950,122 (GRCm39)	missense	probably benign	0.38
R9395:Neu4	UTSW	1	93,950,218 (GRCm39)	missense	probably damaging	1.00
Z1176:Neu4	UTSW	1	93,952,972 (GRCm39)	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TTAGGTGCAGAGGAAACTGAGCCC -3'
(R):5'- ACCAAATGGTGGATTGACCCAAGC -3'

Sequencing Primer
(F):5'- CTATAGATCTCCCTGGAGACTGAG -3'
(R):5'- TGGATTGACCCAAGCAAAGG -3'

Posted On

2013-10-16