Phenotypic Mutation 'porcupine' (pdf version)
List |< first << previous [record 86 of 132] next >> last >|
Alleleporcupine
Mutation Type nonsense
Chromosome5
Coordinate98,254,746 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Fgf5
Gene Name fibroblast growth factor 5
Synonym(s) Fgf-5
Chromosomal Location 98,254,184-98,277,030 bp (+)
MGI Phenotype FUNCTION: This gene encodes a secreted protein that is a member of a family of heparin-binding growth factors. The encoded protein regulates cell proliferation, particularly the growth of hair follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutations in this gene result in significantly longer pelage hair. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010203; MGI: 95519

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
E112* in Ensembl: ENSMUSP00000031280 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 34 72 N/A INTRINSIC
FGF 83 217 3.78e-77 SMART
low complexity region 231 244 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Fgf5 APN 5 98275316 missense probably damaging 1.00
IGL02037:Fgf5 APN 5 98261972 missense probably damaging 1.00
IGL02125:Fgf5 APN 5 98254532 missense possibly damaging 0.55
IGL02926:Fgf5 APN 5 98262015 missense probably damaging 0.99
splinter UTSW 5 98261987 nonsense probably null
ANU22:Fgf5 UTSW 5 98275316 missense probably damaging 1.00
R0090:Fgf5 UTSW 5 98261987 nonsense probably null
R2146:Fgf5 UTSW 5 98275550 makesense probably null
R5023:Fgf5 UTSW 5 98262015 missense probably damaging 0.99
R6035:Fgf5 UTSW 5 98275526 missense probably damaging 1.00
R6035:Fgf5 UTSW 5 98275526 missense probably damaging 1.00
X0018:Fgf5 UTSW 5 98254436 missense unknown
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
Repository

none

Last Updated 2017-10-13 1:36 PM by Anne Murray
Record Created unknown
Record Posted 2012-01-03
Phenotypic Description
The porcupine phenotype of abnormally long pelage hair was identified among G3 mice carrying homozygous ENU-induced mutations. Transmissibility of the phenotype was confirmed by phenotypic reoccurrence in siblings from the same parental breeding pair.

 

 

Nature of Mutation
The porcupine mutation was mapped to Chromosome 5, and corresponds to a G to T transversion at position 562 of the Fgf5 transcript, in exon 1.
 
547 GTCAATGGCTCCCACGAAGCCAGTGTGTTAAGT
107 -V--N--G--S--H--E--A--S--V--L--S-
 
The mutated nucleotide is indicated in red lettering, and creates a premature stop codon in place of glutamic acid 112 resulting in deletion of 153 amino acids from the C terminus of the protein.
Protein Prediction

Figure 1. Domain structure of FGF5 and FGF5s. (A) The canonical FGF5 isoform has 12 highly conserved core regions containing residues and structural motifs common to all FGF family members. These beta sheet regions are shown by green bars 1-12. Additional receptor binding regions and ligand binding sites are indicated by the colored bars above as described in the key. (B) The less common truncated FGF5s isoform has a 4 aa area deleted within the FGF domain. The porcupine mutation results in coding of a premature stop codon at resude 112, and is shown by the red asterisk. This image is interactive, click to see another Fgf5 mutation.

 

Figure 2. Crystallographic structure of human basic Human Growth Factor (PDB #4FGF). The color-coding of the FGF receptor (FGFR) and other binding sites are equivalent to the domain structures in Figure 1. The structure of bFGF is a trigonal pyramid with folds similar to interleukin 1 alpha and beta. It is thought that FGFR activation and signaling are dependent on FGF dimerization, which also may require the binding of heparin (2). The image is interactive. Click to view rotation of the structure. Protein model created with the PyMOL Molecule Graphics System, Version 1.3, Schrödinger, LLC.

Fgf5 encodes a 264-amino acid protein, and like prototypical Fgfs, contains three exons (Figure 1). Fibroblast growth factor (FGF) proteins share a similar internal core region containing 28 highly conserved and six invariant amino acids (1). Ten of these highly conserved residues contribute to ligand-receptor specificity through contact with the FGF receptor (2). Recently, Fgf5 has been shown to encode two alternatively spliced long and short transcripts, resulting in FGF5 and FGF5S proteins, respectively (6). FGF5S lacks the peptide sequence encoded by the second exon of Fgf5 (6). The porcupine mutation creates a stop codon in place of glutamic acid at position 112 of Fgf5 (Figure 1) The mutation may result in a protein-null animal, but this has not been verified.
 
The crystalligraphic structure of human basic FGF is shown above (Figure 2, PDB #4FGF). Crystallographic studies of FGF1 and FGF2 demonstrate that these proteins contain several conserved structural motifs, including 12 antiparallel β strands arranged in a triangular array of 3 four-stranded β sheets (3;4). Within the β strands are distinct binding sites for FGF receptors and heparin (5). Most FGFs contain an N-terminal signal peptide which mediates their secretion from cells. Others are secreted via other mechanisms (1).
Expression/Localization
FGFs are expressed throughout the body in a distinct spatiotemporal pattern, with subfamilies of FGFs generally having similar expression patterns. Fgf5 mRNA is expressed in the mouse embryonic ectoderm prior to gastrulation, and later in the somitic myotome and precursors of certain skeletal muscles (7;8). In the adult mouse, Fgf5 mRNA is found predominantly in the nervous system, in the spinal cord and hippocampus, as well as in hair follicles (9;10). Human FGF5 is a secreted glycoprotein containing heterogeneous amounts of sialic acid (11).
Background
In both humans and mice, the FGF family consists of at least 22 members [reviewed in (1)]. The genes encoding FGFs were generated by gene and chromosomal duplication and by translocation during evolution. Consequently, with the exception of several clusters, they are spread throughout the genome. FGFs play essential roles in tissue morphogenesis during embryonic development and in adulthood by regulating cell proliferation, differentiation and migration. The many FGFs exert their functions by binding to and activating FGF receptors (FGFR), which exist in at least seven isoforms encoded by four alternatively spliced genes (FGFR1-4) (12). FGFs also bind to heparin or heparan sulfate proteoglycans (HSPG), accessory molecules which regulate the binding of FGF to receptor and receptor activation (13-15). Genetic studies in Drosophila support a biological role for the FGF-heparan sulfate interaction, as mutations impairing heparan sulfate biosynthesis also impair FGF signaling during embryonic development (16).
 
FGFRs are transmembrane receptor tyrosine kinases that recruit and activate intracellular signaling proteins controlling cellular events such as proliferation, differentiation and survival [reviewed in (12)]. The binding of FGFs to FGFRs induces receptor dimerization, allowing trans-autophosphorylation of multiple tyrosine residues on receptor intracellular domains. These phosphorylated tyrosines serve as recruitment and binding sites for docking and signaling molecules, including PLCγ (phospholipase Cγ) (17), Shc, FRS2α and FRS2β (fibroblast growth factor receptor substrate 2) (18;19). Major pathways activated by FGFRs are the PLCγ pathway inducing phosphoinositide hydrolysis, the Ras/MAPK pathway, and the PI-3 kinase pathway (12). When inappropriately activated, either by amplification of FGF expression or activating mutations in FGFRs, cells may become transformed to cause tumors (20;21).
 
Targeted mouse mutants of FGFs display a diverse range of phenotypes from embryonic lethality to various tissue-specific phenotypes in adults (1;12). A similar range of phenotypes is observed for FGFR-deficient mice, although in general non-lethal deficiencies in FGFRs appear to cause more severe defects than non-lethal FGF deficiencies. Consistent with this, many FGFs have overlapping patterns of expression, suggesting that functional redundancy exists and that lack of one FGF may be compensated by the function of others.
 
In humans, point mutations in FGFR1, FGFR2 or FGFR3 result in impaired cranial, digital and skeletal development, including craniosynostosis syndromes (premature fusion of cranial sutures), skeletal dysplasia (dwarfism), and distal limb abnormalities (i.e. syndactyly) (22) (OMIM: #136350, #176943, #134934).
 
The original Fgf5 mutants, discovered in 1963, occurred spontaneously in the offspring of BALB/cJ parents (23). Designated angora (go), these mice had exceptionally long, soft hair visible by 18 days of age and remaining through adulthood (23). More recently, researchers definitively demonstrated that the angora phenotype is caused by deletion of most of exon 1 and 2 kb of sequence 5’ of the translation start site of Fgf5, resulting in a null allele (10). The group also generated mice with a targeted mutant allele of Fgf5 (Fgf5neo), and like the angora mice, homozygous Fgf5neo/neo mice exhibit abnormally long pelage hair (10). No other phenotypic abnormalities are observed in Fgf5 mutants. In cats (24) and dogs (25), hair length variability is also associated with the orthologous gene, with mutations resulting in a long-haired phenotype that is recessive to short hair. To date, FGF5 has not been associated with either generalized (hypertrichosis universalis, OMIM: #145700) or localized [e.g. hypertrichosis cubiti (hairy elbows), OMIM: #139600] hair overgrowth.
Putative Mechanism

Figure 3. Hair follicle and growth cycle.  (A) The hair follicle consists of eight epithelial layers including the outer root sheath, companion layer, inner root sheath (consisting of Henle’s, Huxley’s and cuticle layers) and the hair shaft (consisting of the cuticle, cortex and medulla). All layers, with the exception of the outer root sheath, are derived from proliferative cells of the hair matrix, located around the dermal papilla at the base of the hair bulb.  (B) After hair follicles are established, hair is periodically shed and replaced, involving periodic destruction and regeneration of hair follicles.  The hair cycle is divided into three periods: the anagen phase (follicle growth), the catagen phase (regression), and the telogen phase (rest). Several signaling pathways are implicated in hair follicle regeneration. Mutations that affect the indicated stages of the cycle are noted in red text. Genes affected by these mutations are noted in black, italic text. Click on image to reveal related mutations. Click on mutations to view additional information.

The hair cycle consists of three stages: follicle generation and hair production (anagen), follicle regression (catagen), and a resting phase (telogen) (Figure 3). During early postnatal life, the hair cycle progresses synchronously, but later on follicles cycle asynchronously. Although the hair follicles of Fgf5 mutants are structurally normal, Fgf5 mutant hair follicles remain in stage VI of anagen for 3 days longer than wild type hair follicles (26). The lengths of catagen and telogen are normal in Fgf5 mutants. These data suggest that FGF5 promotes the transition from anagen VI to catagen. In support of this, Fgf5 mRNA is expressed in the outer root sheath cells (ORSCs) of hair follicles, where its expression is restricted to the lower third of the of the outer root sheath that surrounds the hair bulb (containing the hair-elongating matrix cells) (10). Fgf5 mRNA expression is initiated just after follicles have entered anagen VI, and downregulated just before the onset of catagen (10).

 

How FGF5 might control the onset of catagen is unknown, but without it, follicles still progress through the hair cycle, albeit at a delayed rate. Several other FGFs, including FGF-1, -2, -7, and -22, are expressed in hair follicles and may therefore functionally compensate for lack of FGF5 (27-29). As mentioned above, Fgf5 encodes two alternatively spliced transcripts resulting in FGF5 and FGF5S proteins, respectively (6). The expression of FGF5 and FGF5S is hair-cycle dependent (30). By injection of purified recombinant FGF5 or FGF5S subcutaneously in mice, FGF5 was shown to inhibit hair growth during anagen, and promote the transition to catagen (31). FGF5S had no effect when injected alone, but when injected with FGF5 it inhibited the catagen-promoting activity of FGF5 (31). FGFR1, the receptor for FGF5, is expressed in the dermal papillae (28). In vitro, dermal papillae cells (DPCs) can be activated by treatment with FGF1 to stimulate ORSC proliferation (32). FGF5 inhibits the proliferation of ORSCs induced by activated DPCs (32). The pathways and molecules controlling these cellular processes are yet unknown.

 

Primers Primers cannot be located by automatic search.
Genotyping
Porcupine genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.
 
Primers for PCR amplification
Porc(F): 5’- GGCGTTATAAATATCCCGGTGCCAG -3’
Porc(R): 5’- AAAAGAGCTGCCTGTCTCACCTCG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Porc_seq(F): 5’- AAGAATGAGCCTGTCCTTGC -3’
Porc_seq(R): 5’- ACCTCGGTAACCTCACCTGG -3’
 
The following sequence of 782 nucleotides (from Genbank genomic region NC_000071 for linear DNA sequence of Fgf5) is amplified:
 
 30                                g gcgttataaa tatcccggtg ccagcgccga
 61 gatccgctcg ggtggcctct ctctctcccc ctctccctct cccttccccg aggctatgtc
121 caccctgtgc ggcgagggag gcagcgccag aggcacgcag ccgcgcgggg gctacggagc
181 ccggagccag ccctgcaaga tgcacttagg acccccgcgg ccggaagaat gagcctgtcc
241 ttgctcttcc tcatcttctg cagccacctg atccacagcg cttgggctca cggggagaag
301 cgtctcactc ccgaagggca acccgcgcct cctaggaacc cgggagactc cagcggcagc
361 cggggcagaa gtagcgcgac gttttcttcg tcttctgcct cctcaccagt cgcagcttct
421 ccgggcagcc aaggaagcgg ctcggaacat agcagtttcc agtggagccc ttcggggcgc
481 cggaccggca gcctgtactg cagagtgggc atcggtttcc atctgcagat ctacccggat
541 ggcaaagtca atggctccca cgaagccagt gtgttaagta agttgctcac tctccaacaa
601 aacctgttct gggagggacg gtcaagattc ctttgggcca caggcacctc taggagccct
661 agcgtctggg actctgctgg ttctggaaag agtccggtag ggtttcgtgg agatgcgtct
721 actcagagcg agcagacgca cccttctgtc ttgggtagta agcatgggta agcccaggtg
781 aggttaccga ggtgagacag gcagctcttt t
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
References
 23.  Dickie, M. M. (1963) Angora, Mouse News Lett 29, 39. (Abstract)
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine, Victoria Webster, Peter Jurek
AuthorsKarine Crozat, Bruce Beutler
List |< first << previous [record 86 of 132] next >> last >|
Edit History
2011-01-07 9:33 AM (current)
2010-02-03 3:31 PM