Allele | porcupine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 98,402,604 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | G ⇒ T (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Fgf5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | fibroblast growth factor 5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Fgf-5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 98,402,108-98,424,892 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: This gene encodes a secreted protein that is a member of a family of heparin-binding growth factors. The encoded protein regulates cell proliferation, particularly the growth of hair follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013] PHENOTYPE: Mutations in this gene result in significantly longer pelage hair. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Glutamic Acid changed to Valine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P15656 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000031280 Gene: ENSMUSG00000029337 AA Change: E112V
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000142420 Gene: ENSMUSG00000029337 AA Change: E112V
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.124) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(5) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(1) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Embryos | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | none | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2017-10-13 1:36 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2012-01-03 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description | The porcupine phenotype of abnormally long pelage hair was identified among G3 mice carrying homozygous ENU-induced mutations. Transmissibility of the phenotype was confirmed by phenotypic reoccurrence in siblings from the same parental breeding pair. |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | The porcupine mutation was mapped to Chromosome 5, and corresponds to a G to T transversion at position 562 of the Fgf5 transcript, in exon 1.
547 GTCAATGGCTCCCACGAAGCCAGTGTGTTAAGT
107 -V--N--G--S--H--E--A--S--V--L--S-
The mutated nucleotide is indicated in red lettering, and creates a premature stop codon in place of glutamic acid 112 resulting in deletion of 153 amino acids from the C terminus of the protein.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Fgf5 encodes a 264-amino acid protein, and like prototypical Fgfs, contains three exons (Figure 1). Fibroblast growth factor (FGF) proteins share a similar internal core region containing 28 highly conserved and six invariant amino acids (1). Ten of these highly conserved residues contribute to ligand-receptor specificity through contact with the FGF receptor (2). Recently, Fgf5 has been shown to encode two alternatively spliced long and short transcripts, resulting in FGF5 and FGF5S proteins, respectively (6). FGF5S lacks the peptide sequence encoded by the second exon of Fgf5 (6). The porcupine mutation creates a stop codon in place of glutamic acid at position 112 of Fgf5 (Figure 1). The mutation may result in a protein-null animal, but this has not been verified.
The crystalligraphic structure of human basic FGF is shown above (Figure 2, PDB #4FGF). Crystallographic studies of FGF1 and FGF2 demonstrate that these proteins contain several conserved structural motifs, including 12 antiparallel β strands arranged in a triangular array of 3 four-stranded β sheets (3;4). Within the β strands are distinct binding sites for FGF receptors and heparin (5). Most FGFs contain an N-terminal signal peptide which mediates their secretion from cells. Others are secreted via other mechanisms (1).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | FGFs are expressed throughout the body in a distinct spatiotemporal pattern, with subfamilies of FGFs generally having similar expression patterns. Fgf5 mRNA is expressed in the mouse embryonic ectoderm prior to gastrulation, and later in the somitic myotome and precursors of certain skeletal muscles (7;8). In the adult mouse, Fgf5 mRNA is found predominantly in the nervous system, in the spinal cord and hippocampus, as well as in hair follicles (9;10). Human FGF5 is a secreted glycoprotein containing heterogeneous amounts of sialic acid (11).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background | In both humans and mice, the FGF family consists of at least 22 members [reviewed in (1)]. The genes encoding FGFs were generated by gene and chromosomal duplication and by translocation during evolution. Consequently, with the exception of several clusters, they are spread throughout the genome. FGFs play essential roles in tissue morphogenesis during embryonic development and in adulthood by regulating cell proliferation, differentiation and migration. The many FGFs exert their functions by binding to and activating FGF receptors (FGFR), which exist in at least seven isoforms encoded by four alternatively spliced genes (FGFR1-4) (12). FGFs also bind to heparin or heparan sulfate proteoglycans (HSPG), accessory molecules which regulate the binding of FGF to receptor and receptor activation (13-15). Genetic studies in Drosophila support a biological role for the FGF-heparan sulfate interaction, as mutations impairing heparan sulfate biosynthesis also impair FGF signaling during embryonic development (16).
FGFRs are transmembrane receptor tyrosine kinases that recruit and activate intracellular signaling proteins controlling cellular events such as proliferation, differentiation and survival [reviewed in (12)]. The binding of FGFs to FGFRs induces receptor dimerization, allowing trans-autophosphorylation of multiple tyrosine residues on receptor intracellular domains. These phosphorylated tyrosines serve as recruitment and binding sites for docking and signaling molecules, including PLCγ (phospholipase Cγ) (17), Shc, FRS2α and FRS2β (fibroblast growth factor receptor substrate 2) (18;19). Major pathways activated by FGFRs are the PLCγ pathway inducing phosphoinositide hydrolysis, the Ras/MAPK pathway, and the PI-3 kinase pathway (12). When inappropriately activated, either by amplification of FGF expression or activating mutations in FGFRs, cells may become transformed to cause tumors (20;21).
Targeted mouse mutants of FGFs display a diverse range of phenotypes from embryonic lethality to various tissue-specific phenotypes in adults (1;12). A similar range of phenotypes is observed for FGFR-deficient mice, although in general non-lethal deficiencies in FGFRs appear to cause more severe defects than non-lethal FGF deficiencies. Consistent with this, many FGFs have overlapping patterns of expression, suggesting that functional redundancy exists and that lack of one FGF may be compensated by the function of others.
In humans, point mutations in FGFR1, FGFR2 or FGFR3 result in impaired cranial, digital and skeletal development, including craniosynostosis syndromes (premature fusion of cranial sutures), skeletal dysplasia (dwarfism), and distal limb abnormalities (i.e. syndactyly) (22) (OMIM: #136350, #176943, #134934).
The original Fgf5 mutants, discovered in 1963, occurred spontaneously in the offspring of BALB/cJ parents (23). Designated angora (go), these mice had exceptionally long, soft hair visible by 18 days of age and remaining through adulthood (23). More recently, researchers definitively demonstrated that the angora phenotype is caused by deletion of most of exon 1 and 2 kb of sequence 5’ of the translation start site of Fgf5, resulting in a null allele (10). The group also generated mice with a targeted mutant allele of Fgf5 (Fgf5neo), and like the angora mice, homozygous Fgf5neo/neo mice exhibit abnormally long pelage hair (10). No other phenotypic abnormalities are observed in Fgf5 mutants. In cats (24) and dogs (25), hair length variability is also associated with the orthologous gene, with mutations resulting in a long-haired phenotype that is recessive to short hair. To date, FGF5 has not been associated with either generalized (hypertrichosis universalis, OMIM: #145700) or localized [e.g. hypertrichosis cubiti (hairy elbows), OMIM: #139600] hair overgrowth.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism |
The hair cycle consists of three stages: follicle generation and hair production (anagen), follicle regression (catagen), and a resting phase (telogen) (Figure 3). During early postnatal life, the hair cycle progresses synchronously, but later on follicles cycle asynchronously. Although the hair follicles of Fgf5 mutants are structurally normal, Fgf5 mutant hair follicles remain in stage VI of anagen for 3 days longer than wild type hair follicles (26). The lengths of catagen and telogen are normal in Fgf5 mutants. These data suggest that FGF5 promotes the transition from anagen VI to catagen. In support of this, Fgf5 mRNA is expressed in the outer root sheath cells (ORSCs) of hair follicles, where its expression is restricted to the lower third of the of the outer root sheath that surrounds the hair bulb (containing the hair-elongating matrix cells) (10). Fgf5 mRNA expression is initiated just after follicles have entered anagen VI, and downregulated just before the onset of catagen (10). How FGF5 might control the onset of catagen is unknown, but without it, follicles still progress through the hair cycle, albeit at a delayed rate. Several other FGFs, including FGF-1, -2, -7, and -22, are expressed in hair follicles and may therefore functionally compensate for lack of FGF5 (27-29). As mentioned above, Fgf5 encodes two alternatively spliced transcripts resulting in FGF5 and FGF5S proteins, respectively (6). The expression of FGF5 and FGF5S is hair-cycle dependent (30). By injection of purified recombinant FGF5 or FGF5S subcutaneously in mice, FGF5 was shown to inhibit hair growth during anagen, and promote the transition to catagen (31). FGF5S had no effect when injected alone, but when injected with FGF5 it inhibited the catagen-promoting activity of FGF5 (31). FGFR1, the receptor for FGF5, is expressed in the dermal papillae (28). In vitro, dermal papillae cells (DPCs) can be activated by treatment with FGF1 to stimulate ORSC proliferation (32). FGF5 inhibits the proliferation of ORSCs induced by activated DPCs (32). The pathways and molecules controlling these cellular processes are yet unknown. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Porcupine genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.
Primers for PCR amplification
Porc(F): 5’- GGCGTTATAAATATCCCGGTGCCAG -3’
Porc(R): 5’- AAAAGAGCTGCCTGTCTCACCTCG -3’
PCR program
1) 94°C 2:00
2) 94°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C ∞
Primers for sequencing
Porc_seq(F): 5’- AAGAATGAGCCTGTCCTTGC -3’
Porc_seq(R): 5’- ACCTCGGTAACCTCACCTGG -3’
The following sequence of 782 nucleotides (from Genbank genomic region NC_000071 for linear DNA sequence of Fgf5) is amplified:
30 g gcgttataaa tatcccggtg ccagcgccga
61 gatccgctcg ggtggcctct ctctctcccc ctctccctct cccttccccg aggctatgtc 121 caccctgtgc ggcgagggag gcagcgccag aggcacgcag ccgcgcgggg gctacggagc 181 ccggagccag ccctgcaaga tgcacttagg acccccgcgg ccggaagaat gagcctgtcc 241 ttgctcttcc tcatcttctg cagccacctg atccacagcg cttgggctca cggggagaag 301 cgtctcactc ccgaagggca acccgcgcct cctaggaacc cgggagactc cagcggcagc 361 cggggcagaa gtagcgcgac gttttcttcg tcttctgcct cctcaccagt cgcagcttct 421 ccgggcagcc aaggaagcgg ctcggaacat agcagtttcc agtggagccc ttcggggcgc 481 cggaccggca gcctgtactg cagagtgggc atcggtttcc atctgcagat ctacccggat 541 ggcaaagtca atggctccca cgaagccagt gtgttaagta agttgctcac tctccaacaa 601 aacctgttct gggagggacg gtcaagattc ctttgggcca caggcacctc taggagccct 661 agcgtctggg actctgctgg ttctggaaag agtccggtag ggtttcgtgg agatgcgtct 721 actcagagcg agcagacgca cccttctgtc ttgggtagta agcatgggta agcccaggtg 781 aggttaccga ggtgagacag gcagctcttt t PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
23. Dickie, M. M. (1963) Angora, Mouse News Lett 29, 39. (Abstract)
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine, Victoria Webster, Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Karine Crozat, Bruce Beutler |