Phenotypic Mutation 'walla'

• Allele: walla
• Mutation Type: missense
• Chromosome: X
• Coordinate: 57,223,465 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Cd40lg
• Gene Name: CD40 ligand
• Synonym(s): gp39, Cd40L, Tnfsf5, Ly-62, CD154, IMD3, HIGM1, T-BAM
• Chromosomal Location: 57,212,143-57,224,042 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed on the surface of T cells. It regulates B cell function by engaging CD40 on the B cell surface. A defect in this gene results in an inability to undergo immunoglobulin class switch and is associated with hyper-IgM syndrome. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Nullizygous mutations affect T-dependent humoral responses, germinal center formation, isotype switching and T cell differentiation, and may alter osteoclastogenesis, thrombogenesis, and susceptibility to autoimmune diabetes and prion infection. ENU mutants fail to show an IgG response to rSFV. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P27548
• SMART Domains: Protein: ENSMUSP00000033466; Gene: ENSMUSG00000031132; AA Change: S221P

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
TNF	121	260	5.79e-33	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000033466)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Not available
• Phenotypic Category: X-linked Recessive
• Penetrance: 100%
• Mode of Inheritance: X-linked Recessive
• Local Stock: Sperm
• MMRRC Submission: 033011-UCD
• Last Updated: 2018-05-17 1:53 PM by Anne Murray
• Record Created: 2010-06-08 4:39 PM by Carrie N. Arnold
• Record Posted: 2010-07-26
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Carrie N. Arnold, Elaine Pirie, Bruce Beutler

Accession Number

NCBI RefSeq: NM_011616.2; MGI: 88337

Alleles Listed at MGI

All alleles(2) : Targeted, knock-out(2)

Phenotypic Description

The walla phenotype was identified by forward genetic screening of ENU-mutagenized G3 mice: a total of three male siblings exhibited null T-dependent IgG responses to rSFV-encoded antigen (T-dependent Humoral Response Screen) but normal T-independent IgM responses and serum IgA levels (T-independent B Cell Response Screen) (see figure). The frequencies and surface phenotypes of peripheral blood T cells and B cells were normal.

Nature of Mutation

Because multiple male walla mice displayed a selective defect in the class-switched response and no obvious defect in lymphocyte development was observed, the X-linked gene encoding CD40 ligand (CD40L) was sequenced. A T to C transition was detected at position 673 of the Cd40lg transcript, in exon 5 of 5 total exons.

 

658 CTTTGCGAGCAGCAGTCTGTTCACTTGGGCGGA

216 -L--C--E--Q--Q--S--V--H--L--G--G-

 

The mutated nucleotide is indicated in red, and results in substitution of serine with proline at position 221 of the CD40L protein.

Protein Prediction

CD40 and CD40L constitute a receptor-ligand pair that provides costimulatory, activating signals to antigen presenting cells (APCs) such as B cells, macrophages, and dendritic cells (DCs). The CD40 receptor, expressed on B cells and other APCs, is engaged by CD40L that is present primarily on activated T cells. A soluble form of CD40L, generated by proteolytic processing of the full length transmembrane protein, is also active (1;2). The protein sequences of human and mouse CD40L are 78% identical.

 

Figure 1. Domain structure of the CD40 ligand protein. ICD = Intracellular domain; TM = Transmembrane domain. The walla mutation converts a serine to a proline at amino acid 221.

CD40L is a member of the tumor necrosis factor (TNF) family of cytokines (3;4) that includes TNFα, lymphotoxin-α (LTα), LTβ, Fas ligand, and TRAIL. Its receptor CD40 is a part of the TNF receptor (TNFR) family. The 260-amino acid mouse CD40L consists of a 22-residue N-terminal intracellular domain, a 24-residue transmembrane segment, a 64-residue extracellular stalk, and a globular TNF-like extracellular domain of 150 amino acids at the C-terminus (Figure 1) (5-9). The soluble form of CD40L consists of amino acids 112-260 of the full length form (1). 

 

Figure 2. Residues 116 through 261 of the extracellular domain of human CD40 ligand. The walla mutation is highlighted in red. UCSF Chimera structure is based on PDB 1ALY. Click on the image to view the structure rotate.

Figure 3. CD40L homotrimer. UCSF Chimera structure is based on PDB 1I9R. Click on the image to view it rotate.

Based on the similarity in primary structure between CD40L and TNF, it was predicted that CD40L would also form a compact trimer (3), a hypothesis that has been confirmed by X-ray crystallographic analysis of the CD40L globular extracellular domain (Figure 2; PDB entry 1aly) (10;11). Similar to those of TNFα and LTα, the extracellular domain of CD40L folds as a sandwich of two β sheets with jellyroll or Greek key topology (10;11). One of the β sheets consists of β strands A”, A, H, C, and F, while the other consists of β strands B’, B, G, D, and E. The extracellular domains of three CD40L molecules interact to form a homotrimer that takes the shape of a pyramid with a truncated apex (Figure 3; PDB entry 1i9r).   The threefold axis of the trimer is approximately parallel to the β strands of each subunit. The CD40-binding site on CD40L has been modeled based on the crystal structure of LTα in complex with TNFR, and on mutagenesis experiments (12;13). The homologous LTα-TNFR structure shows that three TNFR molecules bind to the three available binding sites of LTα (14). Similarly, CD40 interacts with three binding sites on the CD40L trimer, an interaction that induces trimeric association of CD40 and a conformational change that permits the three CD40 molecules to recruit as trimers members of the tumor necrosis factor receptor-associated factor (TRAF) family (15) (see Background). Higher levels of CD40 oligomerization that may be driven by CD40L clustering in the plasma membrane result in more CD40 signaling (16;17).

 

The CD40-binding site consists of a shallow groove between two adjacent CD40L monomers, formed by hydrophobic and hydrophilic residues from both monomers (11;12). These residues are mostly from the AA” and DE loops, with contributions from the CD and GH loops, and strands C, D, G, and H. Site-directed mutagenesis confirms the requirement for amino acids K143, Y145, Y146 (all in AA” loop), R203 (DE loop), and Q220 (strand F) for binding to CD40 (10;11). Interestingly, almost no sequence conservation exists between CD40L and LTα or TNFα in these regions. Comparison of the structure of the uncomplexed CD40L trimer with that of the CD40L trimer in complex with mouse monoclonal antibody 5c8 (which inhibits the CD40L-CD40 interaction) reveals that complex formation does not induce significant conformational changes in CD40L (10).

 

The walla mutation (S→P) at position 221 resides in strand F of the extracellular domain of CD40L.

Expression/Localization

CD40L is expressed by T lymphocytes, predominantly by activated CD4⁺ T cells (7;9), as well as by some CD8⁺ T cells, activated B cells (18) and platelets (19). Under inflammatory conditions, CD40L is induced on monocytes/macrophages (20), natural killer cells (21), mast cells, eosinophils, and basophils. It is localized at the plasma membrane (6;22) and may be cleaved and released extracellularly (1;2).

Background

Figure 4. Overview of the T-dependent humoral immune response Recruitment of antigen-primed T cells During infection, initial contact with antigen activates peripheral dendritic cells (DCs) that acquire the antigen. Activated DCs produce inflammatory cytokines that promote the differentiation of monocytes to form additional DCs, which migrate to the T cell zones of secondary lymphoid organs such as the lymph nodes. There, they activate CD4+ T helper (Th) cells by presenting antigen in an MHC class II context. This results in selection and preferential expansion of antigen-specific Th cell clones. Activated Th cells are induced to transiently express CD40L, permitting them to engage CD40 expressed on DCs. CD40 signaling is essential for the maturation and survival of DCs, resulting in secretion of cytokines, and upregulation of costimulatory molecules. Once activated, Th cells migrate to the border between the B cell follicles and the T cell zone where they encounter antigen-activated B cells. T cell interaction with antigen-primed B cells Naïve B cells reside in the follicles of lymph nodes and move around the heterogeneous reticular network containing follicular dendritic cells (FDCs), CD169+ macrophages, and marginal reticular cells (not shown). While moving along the stromal processes of these cells, B cells encounter antigen presented on FDCs or CD169+ macrophages. FDCs obtain antigen-antibody complexes via their Fc or complement receptors and retain antigen on the cell surface in a native, unprocessed form for long periods of time (e.g. over a year). CD169+ macrophages present antigen within the context of MHC class II. B cells bind antigen through their membrane Ig, leading to antigen endocytosis, proteolytic processing, and presentation at the cell surface within class II MHC molecules. Once activated, B cells migrate to the T/B border where they encounter activated, cognate Th cells expressing CD40L. The peptide-MHC II complex expressed on activated B cells binds to the antigen-specific T cell receptors (TCRs) of Th cells. This B cell/T cell interaction leads to rapid clonal expansion of B cells within the T or B zones. B cells located in T cell zones differentiate into short-lived plasma cells (plasmablasts) that secrete germline-encoded IgM and then IgG, but do not undergo somatic hypermutation. Activated B cells that expand within B cell zones seed secondary follicles and enter the germinal center (GC) reaction. CD40/CD40L interactions are essential for GC formation, progression, and maintenance. Germinal center reaction B cells that enter the GC reaction rapidly proliferate (as centroblasts) and undergo isotype switching and somatic hypermutation. B cells expressing variant BCR exit the cell cyle (as centrocytes) and move to the light zone where they interact with FDCs and antigen-specific Th cells. Centrocytes selected by their ability to interact with antigen held on FDC and/or Th cells either re-enter the GC cycle or further differentiate into long-lived plasma cells or memory B cells with high affinity B cell receptors. B cell/FDC interactions through Fc/Ig and CD21/C3d send a strong survival signal to B cells. However, the majority of centrocytes fail to be selected and undergo apoptosis and clearance by tingible body macrophages. The GC reaction is sustained by signals, including IL-21 and CD40L, from T follicular helper cells (Tfh). Tfh cells also depend on CD40L and IL-21 for their generation and function.

CD40 in humoral immunity

During infection, initial contact with antigen activates tissue-resident dendritic cells (DCs) that acquire antigen before homing to the T cell zones of draining secondary lymphoid organs (Figure 4). There, they activate CD4⁺ T helper (Th) cells by presenting antigen within the context of MHC class II, resulting in selection and preferential expansion of antigen-specific Th cell clones. Activated Th cells are induced to transiently express CD40L (23;24), permitting them to engage CD40 expressed on DCs. CD40 signaling is essential for the maturation and survival of DCs, resulting in enhanced survival, secretion of cytokines such as interleukin (IL)-1, IL-6, IL-8, IL-10, IL-12, and TNFα, and upregulation of costimulatory molecules including ICAM-1 (25), LFA-3, CD80, and CD86.  Conversely, crosslinking CD40L on Th cells contributes to the generation of helper function (26), for example by enhancing cytokine production (27). Once activated, Th cells migrate to the border between the B cell follicles and the T cell zone where they encounter antigen-activated B cells (28).

 

A mature B cell can be activated by antigenic epitopes that are recognized by its cell surface immunoglobulin (Ig) (29). In contrast to T-independent B cell activation in which antigens directly crosslink membrane Ig molecules, T-dependent B cell activation requires ‘cognate help’ from Th cells, which allows B cells to mount responses against proteins and other antigens that cannot crosslink receptors. B cells bind antigen through their membrane Ig, leading to antigen endocytosis, proteolytic processing, and presentation at the cell surface within class II MHC molecules; the peptide-MHC II complex forms the ligand for the antigen-specific T cell receptors (TCRs) of Th cells. Antigen-activated B cells migrate toward T-B cell borders to encounter activated, cognate Th cells expressing CD40L (28). CD40 is constitutively expressed on B cells.

 

B cell induction of an effective humoral response requires the physical interaction, via the immunological synapse, of a B cell with a T cell through the MHC-peptide-TCR complex (30;31). In addition, cytokines as well as secondary cell contact-dependent stimuli, known as costimulatory signals, are required to stimulate sustained B cell growth and differentiation. Through in vitro experiments in which activating monoclonal antibodies against CD40 have been shown to induce B cell proliferation (32-34), cell-cell adhesion (35), differentiation (36;37), and tyrosine phosphorylation (38;39), it was demonstrated that B cells receive a critical costimulatory signal from T cells through CD40. A CD40-Ig fusion protein could block the ability of plasma membrane fractions from activated Th cells to stimulate B cell proliferation and isotype switching (22). Subsequently, the CD40-Ig fusion protein was used to isolate, identify, and clone the ligand for CD40 from activated Th cells (6;22).

The B cell response to T-dependent antigen involves induction of a variety of cell surface molecules, including CD134L (40), Fas (41), CD80 and CD86 (42), within hours of activation. This costimulatory molecule induction requires engagement of CD40 on B cells (43-45). Cell cycle entry follows, with early proliferating B cells located in T cell zones differentiating into short-lived plasma cells (plasmablasts) that secrete germline-encoded IgM and then IgG, but do not undergo somatic hypermutation. Activated B cells that expand within B cell zones seed secondary follicles, rapidly proliferate, and interact with Th cells in the germinal center (GC) reaction where isotype switching and somatic hypermutation occur. Selected GC B cells further differentiate into long-lived plasma cells or memory B cells with high affinity B cell receptors of the switched isotypes. During the selection for high affinity memory B cells, CD40L has been shown to differentially induce either clonal expansion or deletion of B cells in vivo depending on the antigen-specificity of the B cell Ig (46). The concerted action of CD40L and Fas ligand on activated T cells promotes clonal proliferation of B cells stimulated by foreign antigen, whereas CD40L and Fas ligand trigger deletion when B cell receptors have been desensitized by chronic stimulation with self-antigens or have not been bound by antigen.

 

Lack of CD40L:CD40 signaling completely abolishes T-dependent humoral immunity. Thus, blockade of CD40:CD40L interactions between Th cells and cognate B cells using an anti-CD40L blocking antibody abolished the plasmablast response (47). Study of mice deficient in either CD40 or CD40L demonstrated that CD40L:CD40 interactions are also required for GC formation, progression, and maintenance, as well as antibody isotype switching and affinity maturation, with these processes essential for the generation of memory B cells and long-lived plasma cells (48-51). IgM responses to some T-dependent antigens were found to be impaired in CD40L-deficient mice, suggesting that CD40L:CD40 signaling is not only required for secondary Ig responses but also for primary IgM responses. Interestingly, while no GC response was observed in mice lacking CD40L:CD40 signaling, excessive CD40 stimulation during a primary immune response, either using agonistic CD40 antibodies or elevated T cell help, resulted in ablation of GC formation and premature termination of the humoral immune response, blocked the generation of B cell memory and long-lived bone marrow plasma cells, and diverted all B cells to the plasmablast lineage (52). Thus, a normal GC response requires CD40 signaling to fall within a defined range.

 

Once B cells are committed to the GC lineage, the GC reaction is sustained by signals, including IL-21 and CD40L, from T follicular helper cells (T_FH) (53). T_FH cells themselves also depend on CD40L and IL-21 for their generation and function (53;54). Blockade of CD40L with antibodies 6-10 days after priming with a T-dependent antigen abrogated established GCs but had no effect on serum Ig production, suggesting that CD40L:CD40 interactions are required for the initiation but not maintenance of B cell differentiation leading to Ig production (55). However, long-lived bone marrow plasma cells decreased their average affinity for antigen subsequent to blockade of CD40L (56), presumably because of disrupted interactions between cognate GC Th cells and B cells during affinity maturation in the GC.

 

Humans with mutations in CD40L develop a severe form of X-linked immunodeficiency, hyper IgM syndrome 1 (HIGM1, OMIM #308230), characterized by normal to elevated levels of IgM and low levels of IgA, IgG, and IgE, the absence of germinal centers, and the inability to mount a T-dependent humoral response [(57-61), reviewed in (62)]. These phenotypes arise from deficient CD40L:CD40 interaction that is required for T-dependent B cell activation, as described above. As a result, HIGM1 patients suffer from recurrent bacterial infections that typically begin between the first and second years of life. These infections include a high incidence of upper and lower respiratory tract infections, otitis media, and pneumonia (63). Patients are also susceptible to developing autoimmunity, neutropenia, and lymphoproliferative diseases, and to opportunistic infections such as cryptosporidium, Pnuemocystis carinii, mycobacteria, and cytomegalovirus (CMV). T cells from a majority of HIGM1 patients exhibit reduced or absent CD40L protein expression and defective Th function despite normal CD40L mRNA levels (64). A high proportion of mutations occur in the extracellular domain (65), resulting in a range of defective binding ability for several CD40L antibodies (64). Both CD40L- and CD40-deficient mice (48-51) and some 50% of HIGM1 patients (63) display normal levels of circulating IgM, suggesting that an increased IgM level is a secondary phenotype and not a genetically determined feature of the disease.

 

CD40 in cell-mediated immunity

Cell-mediated immunity is carried out by macrophages, granulocytes, natural killer cells, and cytotoxic T lymphocytes stimulated by activated Th cells to destroy intracellular microorganisms. Both humans (63;66) and mice (67-69) deficient in CD40 signaling display increased susceptibility to intracellular infections and the development of lymphomas and gastrointestinal cancers, pointing to a role for CD40L:CD40 signaling in cell-mediated immunity.  

 

CD40L and CD40 play an important role in the priming and expansion of antigen-specific Th cells. Adoptively transferred antigen-specific CD4⁺ T cells lacking CD40L failed to expand upon antigen challenge of the recipients (70). In vitro, Th cells from immunized CD40L-deficient mice proliferated poorly and produced no IL-4 and IFNγ when challenged with priming antigen, although they proliferated normally in response to polyclonal activators. These findings demonstrate that expression of CD40L on T cells is required for priming of CD4⁺ T cells. The requirement for CD40 signaling in T cell priming was also shown in experiments of allograft transplantation in mice. T cells transferred from wild type mice, but not from CD40L-deficient mice, elicited graft-versus-host disease (GVHD) leading to death of recipient mice within 21 days [discussed in (71)]. Persistence of allografts of skin, kidney, pancreatic islets, heart, and lung could be enhanced by co-infusion of donor-specific alloantigen (splenocytes) and anti-CD40L antibody (72-75). In these experiments, antibody blockade of CD40L impaired the upregulation of costimulatory molecules by host DCs, thus preventing them from effectively activating T cells. Alloantigen-presenting, non-matured DCs induced abortive activation and anergy of the host alloreactive T cell pool. CD40 signaling is not only required for the upregulation of costimulatory molecules and cytokine production by DCs, but also for increasing the expression and stability of the MHC:alloantigen complex (76). Signals from CD40 also promote the survival of DCs by upregulating the anti-apoptotic factor Bcl-XL in an NF-κB-dependent manner (see section on CD40 signaling below) (77). 

 

A fundamental role for CD40L:CD40 signaling in monocyte activation by T cells has also been demonstrated. Monocytes upregulate CD40 expression in response to treatment with IFNγ, GM-CSF, or IL-3 (78;79). Engagement of CD40 on macrophages using recombinant CD40L or CD40L-expressing cells resulted in activation of effector function, including production of the proinflammatory cytokines IL-12, IL-6, and TNF-α (78;79). However, CD40L-deficient activated Th cells failed to induce IL-12 or nitric oxide production by macrophages (80-82).

 

Figure 5. Canonical and non-canonical NF-kB signaling pathways. In the canonical pathway, several membrane receptors, including TNFR (tumor-necrosis factor receptor), IL-1R (interleukin-1 receptor) and TLRs (toll-like receptors), signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKα and IKKβ). Ubiquitination can be inhibited by deubiquitinating enzymes (DUB). Stimulation of the T-cell receptor (TCR) and B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles) by 26S proteasome. Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A subset of TNFRs such as the lymphotoxin-β receptor (LT-βR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of Nf-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

CD40L:CD40 signaling

Since CD40, like all TNFR family proteins, lacks intrinsic enzymatic activity, it propagates signaling by recruiting adapter proteins to its cytoplasmic domain. Most CD40 signaling depends on proteins of the TNF receptor-associated factor (TRAF) adapter family that interact directly or indirectly with CD40. TRAF proteins contain a TRAF domain at their C-termini that mediates direct interactions with CD40. At their N-termini, TRAFs (except TRAF1) have a RING finger domain with E3 ubiquitin ligase activity that is critical for signal transduction (83). CD40 contains two distinct domains in its 62-amino acid cytoplasmic tail, cyt-N (membrane-proximal) and cyt-C (membrane-distal), that bind to different members of the TRAF family and can activate NF-κB independently (84-86), although both binding sites are required for optimal NF-κB activation (87). TRAF1, TRAF2, TRAF3, and TRAF5 bind to the minimal consensus sequence (P/H)(V/I)QE(T/S) in cyt-C, whereas TRAF6 binds to the sequence (Q/N/R)X(P/A)XEXX(F/W/Y) in cyt-N (87;88). Upon CD40 engagement, TRAF2 and TRAF3 directly bind to the cytoplasmic tail of CD40; TRAF1 and TRAF5 are recruited to CD40 through associations with CD40-bound TRAFs (88;89).

 

The canonical and non-canonical NF-κB signaling pathways are activated downstream of TRAFs upon CD40L:CD40 engagement, and are major pathways for transducing the effects of CD40 activation (Figure 5). NF-κB proteins are dimeric transcription factors consisting of RelA (p65), RelB, NF-κB1 (p105, processed to p50), NF-κB2 (p100, processed to p52), and c-Rel [reviewed in (90)]. In most cell types, NF-κB dimers are held in the cytoplasm by IκB inhibitory proteins, including IκBα, IκBβ, IκBγ, and the unprocessed p100 and p105 precursors. Activation of NF-κB through the classical pathway depends on degradation of IκB, thus releasing NF-κB to enter the nucleus to coordinate expression of multiple inflammatory and innate immune genes. Briefly, in response to a variety of inflammatory signals, IκBs are phosphorylated on conserved serine residues by the IκB kinase (IKK) complex, composed of IKK-1 (or IKK-α), IKK-2 (or IKK-β) and IKK-γ (NEMO, see panr2).  This modification induces the K48-linked polyubiquitination of IκB molecules and subsequent recognition by the 26S proteasome as substrates for proteolysis. Recruitment of TRAF2, TRAF3, or TRAF6 to CD40 upon CD40L engagement leads to IKK complex activation (91). In the case of TRAF1, which lacks the RING finger domain critical for NF-κB activation, evidence suggests that its role is to regulate the association of other TRAFs with CD40 (89;92;93).

 

Stimulation of CD40 also activates the non-canonical NF-κB pathway, which requires IKK-α, but not the IKK complex, and the proteasome-mediated processing of NF-κB2 (p100) (see xander) to p52 (90;94). In unstimulated cells, a complex consisting of cellular inhibitor of apoptosis (cIAP) 1, cIAP2, TRAF2, and TRAF3 associates with NF-κB inducing kinase (NIK) (see lucky) and promotes constitutive NIK degradation (95;96). CD40 engagement results in recruitment and subsequent degradation of TRAF2 and TRAF3, destabilizing the complex with NIK and permitting NIK accumulation (97-99). NIK binds and phosphorylates both IKK-α and p100 (100-102). Phosphorylation of p100 on two C-terminal sites triggers its polyubiquitination and proteasomal degradation to p52. Since p52 is typically associated with RelB, activation of the non-canonical NF-κB pathway results in nuclear translocation of p52-RelB dimers (103).

 

In support of the essential role of NF-κB signaling downstream of CD40, mice deficient in p50 fail to respond to CD40L stimulation and display impaired class switch recombination and decreased serum IgE (104). B cell-specific knockout of either IKK-β or NEMO results in a lack of B cells in the spleen, suggesting that NF-κB activation by the classical pathway is required for the maintenance of mature B cells (105).   In contrast, non-canonical NF-κB activation by IKK-α and NIK are required for normal B cell development, Ig production, isotype switching, and GC formation (106;107). Mutations in NEMO in humans have been associated with a rare form of X-linked hyper IgM syndrome accompanied by ectodermal dysplasia (108;109).

 

In addition to NF-κB activation, CD40 also mediates its cellular effects by initiating signaling through pathways controlled by p38 MAP kinase, c-Jun, STAT, and Jak3, as well as PI3K and PLC-γ [reviewed in (110)].  Interestingly, whereas CD40-dependent activation of most of these proteins relies on the function of TRAF proteins, Jak3 is activated by binding directly to a proline-rich sequence in the membrane proximal region of the CD40 tail (111). This binding results in phosphorylation, activation, and translocation to the nucleus of STAT3. Jak3 is not required for CD40-mediated B cell proliferation, isotype switching, or upregulation of ICAM-1 or CD80 (112). However, pharmacological inhibition of Jak3 prevented the expression of costimulatory molecules and the production of IL-12 in response to CD40 stimulation of DCs (113).

 

It has been proposed that differential recruitment of TRAFs to the CD40 cytoplasmic tail, as a result of different stimuli, receptor oligomerization states, or cell type, leads to distinct physiological outcomes. This hypothesis is supported by studies of transgenic mice expressing CD40 receptors with mutations in defined TRAF binding sites. Introduction of CD40 with mutations in either the TRAF2/3 or TRAF6 binding sites into Cd40^-/- mice demonstrated that either TRAF2/3 or TRAF6 are sufficient for isotype switching, but both TRAF2/3 and TRAF6 are required for normal GC formation (114;115). In another study, mutation of the TRAF6 binding site in the CD40 cytoplasmic domain resulted in the selective ablation of affinity maturation and generation of long-lived plasma cells after immunization (116). Disruption of both the TRAF6 and TRAF2/3 binding sites was necessary to arrest GC formation in response to immunization. However, CD40-induced B cell proliferation and early Ig production occurred even when all three of these TRAF binding sites were ablated. These intact responses are mediated by TRAF2 binding to a non-canonical site at the C-terminus of CD40 (117;118). This site (SVQE) is sufficient to mediate CD40 signaling leading to NF-κB activation, clonal B cell activation, antibody isotype switching, and affinity maturation. However, GC formation was impaired in transgenic mice expressing only the C-terminal TRAF2 binding motif, indicating that either or both TRAF3 and TRAF5 are necessary for GC formation.

Putative Mechanism

The walla mutation at position 221 of CD40L resides in β strand F of the CD40L extracellular domain. The serine to proline change presumably disrupts the structure of this β strand, and probably the overall structure of the extracellular domain. Binding to CD40 requires Q220, also located in strand F of the CD40L protein (10;11). Together with the phenotype of walla homozygotes, which agrees with that of Cd40^-/- and Cd40lg^-/- mice, these data suggest that CD40L^walla is impaired in its ability to engage CD40 and initiate signaling.

Primers

Primers cannot be located by automatic search.

Genotyping

Walla genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers

walla (F): 5’-CAGTTCTACAGTGGGCCAAGAAAGG -3’

walla (R): 5’- ATAGGGAAGACTGCCAGCATCAGC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C              ∞

 

Primers for sequencing

walla_seq(F): 5’- CCATGAAAAGCAACTTGGTAATGC -3’

walla_seq(R): 5’- AGCATCAGCCCTGCTGC -3’

 

The following sequence of 432 nucleotides (from Genbank genomic region NC_000086 for linear genomic sequence of Cd40lg, sense strand) is amplified:

 

11066                            cagtt ctacagtggg ccaagaaagg atattatacc

11101 atgaaaagca acttggtaat gcttgaaaat gggaaacagc tgacggttaa aagagaagga

11161 ctctattatg tctacactca agtcaccttc tgctctaatc gggagccttc gagtcaacgc

11221 ccattcatcg tcggcctctg gctgaagccc agcagtggat ctgagagaat cttactcaag

11281 gcggcaaata cccacagttc ctcccagctt tgcgagcagc agtctgttca cttgggcgga

11341 gtgtttgaat tacaagctgg tgcttctgtg tttgtcaacg tgactgaagc aagccaagtg

11401 atccacagag ttggcttctc atcttttggc ttactcaaac tctgaacagt gcgctgtcct

11461 aggctgcagc agggctgatg ctggcagtct tccctat

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

  1. Graf, D., Muller, S., Korthauer, U., van Kooten, C., Weise, C., and Kroczek, R. A. (1995) A Soluble Form of TRAP (CD40 Ligand) is Rapidly Released After T Cell Activation. Eur. J. Immunol.. 25, 1749-1754.

  2. Mazzei, G. J., Edgerton, M. D., Losberger, C., Lecoanet-Henchoz, S., Graber, P., Durandy, A., Gauchat, J. F., Bernard, A., Allet, B., and Bonnefoy, J. Y. (1995) Recombinant Soluble Trimeric CD40 Ligand is Biologically Active. J. Biol. Chem.. 270, 7025-7028.

  3. Peitsch, M. C., and Jongeneel, C. V. (1993) A 3-D Model for the CD40 Ligand Predicts that it is a Compact Trimer Similar to the Tumor Necrosis Factors. Int. Immunol.. 5, 233-238.

  4. Farrah, T., and Smith, C. A. (1992) Emerging Cytokine Family. Nature. 358, 26.

  5. Gauchat, J. F., Aubry, J. P., Mazzei, G., Life, P., Jomotte, T., Elson, G., and Bonnefoy, J. Y. (1993) Human CD40-Ligand: Molecular Cloning, Cellular Distribution and Regulation of Expression by Factors Controlling IgE Production. FEBS Lett.. 315, 259-266.

  6. Armitage, R. J., Fanslow, W. C., Strockbine, L., Sato, T. A., Clifford, K. N., Macduff, B. M., Anderson, D. M., Gimpel, S. D., Davis-Smith, T., and Maliszewski, C. R. (1992) Molecular and Biological Characterization of a Murine Ligand for CD40. Nature. 357, 80-82.

  7. Spriggs, M. K., Armitage, R. J., Strockbine, L., Clifford, K. N., Macduff, B. M., Sato, T. A., Maliszewski, C. R., and Fanslow, W. C. (1992) Recombinant Human CD40 Ligand Stimulates B Cell Proliferation and Immunoglobulin E Secretion. J. Exp. Med.. 176, 1543-1550.

  8. Hollenbaugh, D., Grosmaire, L. S., Kullas, C. D., Chalupny, N. J., Braesch-Andersen, S., Noelle, R. J., Stamenkovic, I., Ledbetter, J. A., and Aruffo, A. (1992) The Human T Cell Antigen gp39, a Member of the TNF Gene Family, is a Ligand for the CD40 Receptor: Expression of a Soluble Form of gp39 with B Cell Co-Stimulatory Activity. EMBO J.. 11, 4313-4321.

  9. Graf, D., Korthauer, U., Mages, H. W., Senger, G., and Kroczek, R. A. (1992) Cloning of TRAP, a Ligand for CD40 on Human T Cells. Eur. J. Immunol.. 22, 3191-3194.

  10. Karpusas, M., Lucci, J., Ferrant, J., Benjamin, C., Taylor, F. R., Strauch, K., Garber, E., and Hsu, Y. M. (2001) Structure of CD40 Ligand in Complex with the Fab Fragment of a Neutralizing Humanized Antibody. Structure. 9, 321-329.

  11. Karpusas, M., Hsu, Y. M., Wang, J. H., Thompson, J., Lederman, S., Chess, L., and Thomas, D. (1995) 2 A Crystal Structure of an Extracellular Fragment of Human CD40 Ligand. Structure. 3, 1031-1039.

  12. Bajorath, J., Marken, J. S., Chalupny, N. J., Spoon, T. L., Siadak, A. W., Gordon, M., Noelle, R. J., Hollenbaugh, D., and Aruffo, A. (1995) Analysis of gp39/CD40 Interactions using Molecular Models and Site-Directed Mutagenesis. Biochemistry. 34, 9884-9892.

  13. Bajorath, J., Chalupny, N. J., Marken, J. S., Siadak, A. W., Skonier, J., Gordon, M., Hollenbaugh, D., Noelle, R. J., Ochs, H. D., and Aruffo, A. (1995) Identification of Residues on CD40 and its Ligand which are Critical for the Receptor-Ligand Interaction. Biochemistry. 34, 1833-1844.

  14. Banner, D. W., D'Arcy, A., Janes, W., Gentz, R., Schoenfeld, H. J., Broger, C., Loetscher, H., and Lesslauer, W. (1993) Crystal Structure of the Soluble Human 55 Kd TNF Receptor-Human TNF Beta Complex: Implications for TNF Receptor Activation. Cell. 73, 431-445.

  15. McWhirter, S. M., Pullen, S. S., Holton, J. M., Crute, J. J., Kehry, M. R., and Alber, T. (1999) Crystallographic Analysis of CD40 Recognition and Signaling by Human TRAF2. Proc. Natl. Acad. Sci. U. S. A.. 96, 8408-8413.

  16. Haswell, L. E., Glennie, M. J., and Al-Shamkhani, A. (2001) Analysis of the Oligomeric Requirement for Signaling by CD40 using Soluble Multimeric Forms of its Ligand, CD154. Eur. J. Immunol.. 31, 3094-3100.

  17. Pound, J. D., Challa, A., Holder, M. J., Armitage, R. J., Dower, S. K., Fanslow, W. C., Kikutani, H., Paulie, S., Gregory, C. D., and Gordon, J. (1999) Minimal Cross-Linking and Epitope Requirements for CD40-Dependent Suppression of Apoptosis Contrast with those for Promotion of the Cell Cycle and Homotypic Adhesions in Human B Cells. Int. Immunol.. 11, 11-20.

  18. Grammer, A. C., Bergman, M. C., Miura, Y., Fujita, K., Davis, L. S., and Lipsky, P. E. (1995) The CD40 Ligand Expressed by Human B Cells Costimulates B Cell Responses. J. Immunol.. 154, 4996-5010.

  19. Elzey, B. D., Tian, J., Jensen, R. J., Swanson, A. K., Lees, J. R., Lentz, S. R., Stein, C. S., Nieswandt, B., Wang, Y., Davidson, B. L., and Ratliff, T. L. (2003) Platelet-Mediated Modulation of Adaptive Immunity. A Communication Link between Innate and Adaptive Immune Compartments. Immunity. 19, 9-19.

  20. Mach, F., Schonbeck, U., Sukhova, G. K., Bourcier, T., Bonnefoy, J. Y., Pober, J. S., and Libby, P. (1997) Functional CD40 Ligand is Expressed on Human Vascular Endothelial Cells, Smooth Muscle Cells, and Macrophages: Implications for CD40-CD40 Ligand Signaling in Atherosclerosis. Proc. Natl. Acad. Sci. U. S. A.. 94, 1931-1936.

  21. Carbone, E., Ruggiero, G., Terrazzano, G., Palomba, C., Manzo, C., Fontana, S., Spits, H., Karre, K., and Zappacosta, S. (1997) A New Mechanism of NK Cell Cytotoxicity Activation: The CD40-CD40 Ligand Interaction. J. Exp. Med.. 185, 2053-2060.

  22. Noelle, R. J., Roy, M., Shepherd, D. M., Stamenkovic, I., Ledbetter, J. A., and Aruffo, A. (1992) A 39-kDa Protein on Activated Helper T Cells Binds CD40 and Transduces the Signal for Cognate Activation of B Cells. Proc. Natl. Acad. Sci. U. S. A.. 89, 6550-6554.

  23. Casamayor-Palleja, M., Khan, M., and MacLennan, I. C. (1995) A Subset of CD4+ Memory T Cells Contains Preformed CD40 Ligand that is Rapidly but Transiently Expressed on their Surface After Activation through the T Cell Receptor Complex. J. Exp. Med.. 181, 1293-1301.

  24. Van den Eertwegh, A. J., Noelle, R. J., Roy, M., Shepherd, D. M., Aruffo, A., Ledbetter, J. A., Boersma, W. J., and Claassen, E. (1993) In Vivo CD40-gp39 Interactions are Essential for Thymus-Dependent Humoral Immunity. I. in Vivo Expression of CD40 Ligand, Cytokines, and Antibody Production Delineates Sites of Cognate T-B Cell Interactions. J. Exp. Med.. 178, 1555-1565.

  25. Shinde, S., Wu, Y., Guo, Y., Niu, Q., Xu, J., Grewal, I. S., Flavell, R., and Liu, Y. (1996) CD40L is Important for Induction of, but Not Response to, Costimulatory Activity. ICAM-1 as the Second Costimulatory Molecule Rapidly Up-Regulated by CD40L. J. Immunol.. 157, 2764-2768.

  26. van Essen, D., Kikutani, H., and Gray, D. (1995) CD40 Ligand-Transduced Co-Stimulation of T Cells in the Development of Helper Function. Nature. 378, 620-623.

  27. Poudrier, J., van Essen, D., Morales-Alcelay, S., Leanderson, T., Bergthorsdottir, S., and Gray, D. (1998) CD40 Ligand Signals Optimize T Helper Cell Cytokine Production: Role in Th2 Development and Induction of Germinal Centers. Eur. J. Immunol.. 28, 3371-3383.

  28. Garside, P., Ingulli, E., Merica, R. R., Johnson, J. G., Noelle, R. J., and Jenkins, M. K. (1998) Visualization of Specific B and T Lymphocyte Interactions in the Lymph Node. Science. 281, 96-99.

  29. McHeyzer-Williams, M. (2003) B-Cell Signaling Mechanisms and Activation, in Fundamental Immunology (W. E. Paul, Ed.) 5th ed., pp 195-225, Lippincott Williams & Wilkins, Philadelphia, PA.

  30. Mitchison, N. A. (2004) T-Cell-B-Cell Cooperation. Nat. Rev. Immunol.. 4, 308-312.

  31. Huppa, J. B., and Davis, M. M. (2003) T-Cell-Antigen Recognition and the Immunological Synapse. Nat. Rev. Immunol.. 3, 973-983.

  32. Banchereau, J., de Paoli, P., Valle, A., Garcia, E., and Rousset, F. (1991) Long-Term Human B Cell Lines Dependent on Interleukin-4 and Antibody to CD40. Science. 251, 70-72.

  33. Paulie, S., Rosen, A., Ehlin-Henriksson, B., Braesch-Andersen, S., Jakobson, E., Koho, H., and Perlmann, P. (1989) The Human B Lymphocyte and Carcinoma Antigen, CDw40, is a Phosphoprotein Involved in Growth Signal Transduction. J. Immunol.. 142, 590-595.

  34. Clark, E. A., and Ledbetter, J. A. (1986) Activation of Human B Cells Mediated through Two Distinct Cell Surface Differentiation Antigens, Bp35 and Bp50. Proc. Natl. Acad. Sci. U. S. A.. 83, 4494-4498.

  35. Barrett, T. B., Shu, G., and Clark, E. A. (1991) CD40 Signaling Activates CD11a/CD18 (LFA-1)-Mediated Adhesion in B Cells. J. Immunol.. 146, 1722-1729.

  36. Zhang, K., Clark, E. A., and Saxon, A. (1991) CD40 Stimulation Provides an IFN-Gamma-Independent and IL-4-Dependent Differentiation Signal Directly to Human B Cells for IgE Production. J. Immunol.. 146, 1836-1842.

  37. Jabara, H. H., Fu, S. M., Geha, R. S., and Vercelli, D. (1990) CD40 and IgE: Synergism between Anti-CD40 Monoclonal Antibody and Interleukin 4 in the Induction of IgE Synthesis by Highly Purified Human B Cells. J. Exp. Med.. 172, 1861-1864.

  38. Faris, M., Gaskin, F., Parsons, J. T., and Fu, S. M. (1994) CD40 Signaling Pathway: Anti-CD40 Monoclonal Antibody Induces Rapid Dephosphorylation and Phosphorylation of Tyrosine-Phosphorylated Proteins Including Protein Tyrosine Kinase Lyn, Fyn, and Syk and the Appearance of a 28-kD Tyrosine Phosphorylated Protein. J. Exp. Med.. 179, 1923-1931.

  39. Uckun, F. M., Schieven, G. L., Dibirdik, I., Chandan-Langlie, M., Tuel-Ahlgren, L., and Ledbetter, J. A. (1991) Stimulation of Protein Tyrosine Phosphorylation, Phosphoinositide Turnover, and Multiple Previously Unidentified serine/threonine-Specific Protein Kinases by the Pan-B-Cell Receptor CD40/Bp50 at Discrete Developmental Stages of Human B-Cell Ontogeny. J. Biol. Chem.. 266, 17478-17485.

  40. Murata, K., Ishii, N., Takano, H., Miura, S., Ndhlovu, L. C., Nose, M., Noda, T., and Sugamura, K. (2000) Impairment of Antigen-Presenting Cell Function in Mice Lacking Expression of OX40 Ligand. J. Exp. Med.. 191, 365-374.

  41. Krammer, P. H. (2000) CD95's Deadly Mission in the Immune System. Nature. 407, 789-795.

  42. Greenwald, R. J., Freeman, G. J., and Sharpe, A. H. (2005) The B7 Family Revisited. Annu. Rev. Immunol.. 23, 515-548.

  43. Wu, Y., Xu, J., Shinde, S., Grewal, I., Henderson, T., Flavell, R. A., and Liu, Y. (1995) Rapid Induction of a Novel Costimulatory Activity on B Cells by CD40 Ligand. Curr. Biol.. 5, 1303-1311.

  44. Roy, M., Aruffo, A., Ledbetter, J., Linsley, P., Kehry, M., and Noelle, R. (1995) Studies on the Interdependence of gp39 and B7 Expression and Function during Antigen-Specific Immune Responses. Eur. J. Immunol.. 25, 596-603.

  45. Ranheim, E. A., and Kipps, T. J. (1993) Activated T Cells Induce Expression of B7/BB1 on Normal Or Leukemic B Cells through a CD40-Dependent Signal. J. Exp. Med.. 177, 925-935.

  46. Rathmell, J. C., Townsend, S. E., Xu, J. C., Flavell, R. A., and Goodnow, C. C. (1996) Expansion Or Elimination of B Cells in Vivo: Dual Roles for CD40- and Fas (CD95)-Ligands Modulated by the B Cell Antigen Receptor. Cell. 87, 319-329.

  47. Foy, T. M., Shepherd, D. M., Durie, F. H., Aruffo, A., Ledbetter, J. A., and Noelle, R. J. (1993) In Vivo CD40-gp39 Interactions are Essential for Thymus- Dependent Humoral Immunity. II. Prolonged Suppression of the Humoral Immune Response by an Antibody to the Ligand for CD40, gp39. J. Exp. Med.. 178, 1567-1575.

  48. Foy, T. M., Laman, J. D., Ledbetter, J. A., Aruffo, A., Claassen, E., and Noelle, R. J. (1994) Gp39-CD40 Interactions are Essential for Germinal Center Formation and the Development of B Cell Memory. J. Exp. Med.. 180, 157-163.

  49. Renshaw, B. R., Fanslow, W. C.,3rd, Armitage, R. J., Campbell, K. A., Liggitt, D., Wright, B., Davison, B. L., and Maliszewski, C. R. (1994) Humoral Immune Responses in CD40 Ligand-Deficient Mice. J. Exp. Med.. 180, 1889-1900.

  50. Xu, J., Foy, T. M., Laman, J. D., Elliott, E. A., Dunn, J. J., Waldschmidt, T. J., Elsemore, J., Noelle, R. J., and Flavell, R. A. (1994) Mice Deficient for the CD40 Ligand. Immunity. 1, 423-431.

  51. Kawabe, T., Naka, T., Yoshida, K., Tanaka, T., Fujiwara, H., Suematsu, S., Yoshida, N., Kishimoto, T., and Kikutani, H. (1994) The Immune Responses in CD40-Deficient Mice: Impaired Immunoglobulin Class Switching and Germinal Center Formation. Immunity. 1, 167-178.

  52. Erickson, L. D., Durell, B. G., Vogel, L. A., O'Connor, B. P., Cascalho, M., Yasui, T., Kikutani, H., and Noelle, R. J. (2002) Short-Circuiting Long-Lived Humoral Immunity by the Heightened Engagement of CD40. J. Clin. Invest.. 109, 613-620.

  53. King, C., Tangye, S. G., and Mackay, C. R. (2008) T Follicular Helper (TFH) Cells in Normal and Dysregulated Immune Responses. Annu. Rev. Immunol.. 26, 741-766.

  54. Vogelzang, A., McGuire, H. M., Yu, D., Sprent, J., Mackay, C. R., and King, C. (2008) A Fundamental Role for Interleukin-21 in the Generation of T Follicular Helper Cells. Immunity. 29, 127-137.

  55. Han, S., Hathcock, K., Zheng, B., Kepler, T. B., Hodes, R., and Kelsoe, G. (1995) Cellular Interaction in Germinal Centers. Roles of CD40 Ligand and B7-2 in Established Germinal Centers. J. Immunol.. 155, 556-567.

  56. Takahashi, Y., Dutta, P. R., Cerasoli, D. M., and Kelsoe, G. (1998) In Situ Studies of the Primary Immune Response to (4-Hydroxy-3-Nitrophenyl)Acetyl. V. Affinity Maturation Develops in Two Stages of Clonal Selection. J. Exp. Med.. 187, 885-895.

  57. Fuleihan, R., Ramesh, N., Loh, R., Jabara, H., Rosen, R. S., Chatila, T., Fu, S. M., Stamenkovic, I., and Geha, R. S. (1993) Defective Expression of the CD40 Ligand in X Chromosome-Linked Immunoglobulin Deficiency with Normal Or Elevated IgM. Proc. Natl. Acad. Sci. U. S. A.. 90, 2170-2173.

  58. Allen, R. C., Armitage, R. J., Conley, M. E., Rosenblatt, H., Jenkins, N. A., Copeland, N. G., Bedell, M. A., Edelhoff, S., Disteche, C. M., and Simoneaux, D. K. (1993) CD40 Ligand Gene Defects Responsible for X-Linked Hyper-IgM Syndrome. Science. 259, 990-993.

  59. DiSanto, J. P., Bonnefoy, J. Y., Gauchat, J. F., Fischer, A., and de Saint Basile, G. (1993) CD40 Ligand Mutations in x-Linked Immunodeficiency with Hyper-IgM. Nature. 361, 541-543.

  60. Korthauer, U., Graf, D., Mages, H. W., Briere, F., Padayachee, M., Malcolm, S., Ugazio, A. G., Notarangelo, L. D., Levinsky, R. J., and Kroczek, R. A. (1993) Defective Expression of T-Cell CD40 Ligand Causes X-Linked Immunodeficiency with Hyper-IgM. Nature. 361, 539-541.

  61. Aruffo, A., Farrington, M., Hollenbaugh, D., Li, X., Milatovich, A., Nonoyama, S., Bajorath, J., Grosmaire, L. S., Stenkamp, R., and Neubauer, M. (1993) The CD40 Ligand, gp39, is Defective in Activated T Cells from Patients with X-Linked Hyper-IgM Syndrome. Cell. 72, 291-300.

  62. Bhushan, A., and Covey, L. R. (2001) CD40:CD40L Interactions in X-Linked and Non-X-Linked Hyper-IgM Syndromes. Immunol. Res.. 24, 311-324.

  63. Levy, J., Espanol-Boren, T., Thomas, C., Fischer, A., Tovo, P., Bordigoni, P., Resnick, I., Fasth, A., Baer, M., Gomez, L., Sanders, E. A., Tabone, M. D., Plantaz, D., Etzioni, A., Monafo, V., Abinun, M., Hammarstrom, L., Abrahamsen, T., Jones, A., Finn, A., Klemola, T., DeVries, E., Sanal, O., Peitsch, M. C., and Notarangelo, L. D. (1997) Clinical Spectrum of X-Linked Hyper-IgM Syndrome. J. Pediatr.. 131, 47-54.

  64. Seyama, K., Nonoyama, S., Gangsaas, I., Hollenbaugh, D., Pabst, H. F., Aruffo, A., and Ochs, H. D. (1998) Mutations of the CD40 Ligand Gene and its Effect on CD40 Ligand Expression in Patients with X-Linked Hyper IgM Syndrome. Blood. 92, 2421-2434.

  65. Notarangelo, L. D., Peitsch, M. C., Abrahamsen, T. G., Bachelot, C., Bordigoni, P., Cant, A. J., Chapel, H., Clementi, M., Deacock, S., de Saint Basile, G., Duse, M., Espanol, T., Etzioni, A., Fasth, A., Fischer, A., Giliani, S., Gomez, L., Hammarstorm, L., Jones, A., Kanariou, M., Kinnon, C., Klemola, T., Kroczek, R. A., Levy, J., Matamoros, N., Monafo, V., Paolucci, P., Reznick, I., Sanal, O., Smith, C. I., Thompson, R. A., Tovo, P., Villa, A., Vihinen, M., Vossen, J., and Zegers, B. J. (1996) CD40lbase: A Database of CD40L Gene Mutations Causing X-Linked Hyper-IgM Syndrome. Immunol. Today. 17, 511-516.

  66. Hayward, A. R., Levy, J., Facchetti, F., Notarangelo, L., Ochs, H. D., Etzioni, A., Bonnefoy, J. Y., Cosyns, M., and Weinberg, A. (1997) Cholangiopathy and Tumors of the Pancreas, Liver, and Biliary Tree in Boys with X-Linked Immunodeficiency with Hyper-IgM. J. Immunol.. 158, 977-983.

  67. Soong, L., Xu, J. C., Grewal, I. S., Kima, P., Sun, J., Longley, B. J.,Jr, Ruddle, N. H., McMahon-Pratt, D., and Flavell, R. A. (1996) Disruption of CD40-CD40 Ligand Interactions Results in an Enhanced Susceptibility to Leishmania Amazonensis Infection. Immunity. 4, 263-273.

  68. Campbell, K. A., Ovendale, P. J., Kennedy, M. K., Fanslow, W. C., Reed, S. G., and Maliszewski, C. R. (1996) CD40 Ligand is Required for Protective Cell-Mediated Immunity to Leishmania Major. Immunity. 4, 283-289.

  69. Wiley, J. A., and Harmsen, A. G. (1995) CD40 Ligand is Required for Resolution of Pneumocystis Carinii Pneumonia in Mice. J. Immunol.. 155, 3525-3529.

  70. Grewal, I. S., Xu, J. C., and Flavell, R. A. (1995) Impairment of Antigen-Specific T-Cell Priming in Mice Lacking CD40 Ligand. Nature. 378, 617-620.

  71. Grewal, I. S., and Flavell, R. A. (1998) CD40 and CD154 in Cell-Mediated Immunity. Annu. Rev. Immunol.. 16, 111-135.

  72. Chalermskulrat, W., McKinnon, K. P., Brickey, W. J., Neuringer, I. P., Park, R. C., Sterka, D. G., Long, B. R., McNeillie, P., Noelle, R. J., Ting, J. P., and Aris, R. M. (2006) Combined Donor Specific Transfusion and Anti-CD154 Therapy Achieves Airway Allograft Tolerance. Thorax. 61, 61-67.

  73. Quezada, S. A., Fuller, B., Jarvinen, L. Z., Gonzalez, M., Blazar, B. R., Rudensky, A. Y., Strom, T. B., and Noelle, R. J. (2003) Mechanisms of Donor-Specific Transfusion Tolerance: Preemptive Induction of Clonal T-Cell Exhaustion Via Indirect Presentation. Blood. 102, 1920-1926.

  74. Larsen, C. P., Alexander, D. Z., Hollenbaugh, D., Elwood, E. T., Ritchie, S. C., Aruffo, A., Hendrix, R., and Pearson, T. C. (1996) CD40-gp39 Interactions Play a Critical Role during Allograft Rejection. Suppression of Allograft Rejection by Blockade of the CD40-gp39 Pathway. Transplantation. 61, 4-9.

  75. Parker, D. C., Greiner, D. L., Phillips, N. E., Appel, M. C., Steele, A. W., Durie, F. H., Noelle, R. J., Mordes, J. P., and Rossini, A. A. (1995) Survival of Mouse Pancreatic Islet Allografts in Recipients Treated with Allogeneic Small Lymphocytes and Antibody to CD40 Ligand. Proc. Natl. Acad. Sci. U. S. A.. 92, 9560-9564.

  76. Frleta, D., Lin, J. T., Quezada, S. A., Wade, T. K., Barth, R. J., Noelle, R. J., and Wade, W. F. (2003) Distinctive Maturation of in Vitro Versus in Vivo Anti-CD40 mAb-Matured Dendritic Cells in Mice. J. Immunother.. 26, 72-84.

  77. Ouaaz, F., Arron, J., Zheng, Y., Choi, Y., and Beg, A. A. (2002) Dendritic Cell Development and Survival Require Distinct NF-kappaB Subunits. Immunity. 16, 257-270.

  78. Kiener, P. A., Moran-Davis, P., Rankin, B. M., Wahl, A. F., Aruffo, A., and Hollenbaugh, D. (1995) Stimulation of CD40 with Purified Soluble gp39 Induces Proinflammatory Responses in Human Monocytes. J. Immunol.. 155, 4917-4925.

  79. Alderson, M. R., Armitage, R. J., Tough, T. W., Strockbine, L., Fanslow, W. C., and Spriggs, M. K. (1993) CD40 Expression by Human Monocytes: Regulation by Cytokines and Activation of Monocytes by the Ligand for CD40. J. Exp. Med.. 178, 669-674.

  80. Kennedy, M. K., Picha, K. S., Fanslow, W. C., Grabstein, K. H., Alderson, M. R., Clifford, K. N., Chin, W. A., and Mohler, K. M. (1996) CD40/CD40 Ligand Interactions are Required for T Cell-Dependent Production of Interleukin-12 by Mouse Macrophages. Eur. J. Immunol.. 26, 370-378.

  81. Stout, R. D., Suttles, J., Xu, J., Grewal, I. S., and Flavell, R. A. (1996) Impaired T Cell-Mediated Macrophage Activation in CD40 Ligand-Deficient Mice. J. Immunol.. 156, 8-11.

  82. Shu, U., Kiniwa, M., Wu, C. Y., Maliszewski, C., Vezzio, N., Hakimi, J., Gately, M., and Delespesse, G. (1995) Activated T Cells Induce Interleukin-12 Production by Monocytes Via CD40-CD40 Ligand Interaction. Eur. J. Immunol.. 25, 1125-1128.

  83. Takeuchi, M., Rothe, M., and Goeddel, D. V. (1996) Anatomy of TRAF2 - Distinct Domains for Nuclear Factor- kappaB Activation and Association with Tumor Necrosis Factor Signaling Proteins. J. Biol. Chem.. 271, 19935-19942.

  84. Tsukamoto, N., Kobayashi, N., Azuma, S., Yamamoto, T., and Inoue, J. (1999) Two Differently Regulated Nuclear Factor kappaB Activation Pathways Triggered by the Cytoplasmic Tail of CD40. Proc. Natl. Acad. Sci. U. S. A.. 96, 1234-1239.

  85. Ishida, T., Mizushima, S., Azuma, S., Kobayashi, N., Tojo, T., Suzuki, K., Aizawa, S., Watanabe, T., Mosialos, G., Kieff, E., Yamamoto, T., and Inoue, J. (1996) Identification of TRAF6, a Novel Tumor Necrosis Factor Receptor-Associated Factor Protein that Mediates Signaling from an Amino-Terminal Domain of the CD40 Cytoplasmic Region. J. Biol. Chem.. 271, 28745-28748.

  86. Cheng, G., and Baltimore, D. (1996) TANK, a Co-Inducer with TRAF2 of TNF- and CD 40L-Mediated NF-kappaB Activation. Genes Dev.. 10, 963-973.

  87. Pullen, S. S., Dang, T. T., Crute, J. J., and Kehry, M. R. (1999) CD40 Signaling through Tumor Necrosis Factor Receptor-Associated Factors (TRAFs). Binding Site Specificity and Activation of Downstream Pathways by Distinct TRAFs. J. Biol. Chem.. 274, 14246-14254.

  88. Pullen, S. S., Miller, H. G., Everdeen, D. S., Dang, T. T., Crute, J. J., and Kehry, M. R. (1998) CD40-Tumor Necrosis Factor Receptor-Associated Factor (TRAF) Interactions: Regulation of CD40 Signaling through Multiple TRAF Binding Sites and TRAF Hetero-Oligomerization. Biochemistry. 37, 11836-11845.

  89. Xie, P., Hostager, B. S., Munroe, M. E., Moore, C. R., and Bishop, G. A. (2006) Cooperation between TNF Receptor-Associated Factors 1 and 2 in CD40 Signaling. J. Immunol.. 176, 5388-5400.

  90. Bonizzi, G., and Karin, M. (2004) The Two NF-kappaB Activation Pathways and their Role in Innate and Adaptive Immunity. Trends Immunol.. 25, 280-288.

  91. Kosaka, Y., Calderhead, D. M., Manning, E. M., Hambor, J. E., Black, A., Geleziunas, R., Marcu, K. B., and Noelle, R. J. (1999) Activation and Regulation of the IkappaB Kinase in Human B Cells by CD40 Signaling. Eur. J. Immunol.. 29, 1353-1362.

  92. Leo, E., Welsh, K., Matsuzawa, S., Zapata, J. M., Kitada, S., Mitchell, R. S., Ely, K. R., and Reed, J. C. (1999) Differential Requirements for Tumor Necrosis Factor Receptor-Associated Factor Family Proteins in CD40-Mediated Induction of NF-kappaB and Jun N-Terminal Kinase Activation. J. Biol. Chem.. 274, 22414-22422.

  93. Arron, J. R., Pewzner-Jung, Y., Walsh, M. C., Kobayashi, T., and Choi, Y. (2002) Regulation of the Subcellular Localization of Tumor Necrosis Factor Receptor-Associated Factor (TRAF)2 by TRAF1 Reveals Mechanisms of TRAF2 Signaling. J. Exp. Med.. 196, 923-934.

  94. Senftleben, U., Cao, Y., Xiao, G., Greten, F. R., Krahn, G., Bonizzi, G., Chen, Y., Hu, Y., Fong, A., Sun, S. C., and Karin, M. (2001) Activation by IKKalpha of a Second, Evolutionary Conserved, NF-Kappa B Signaling Pathway. Science. 293, 1495-1499.

  95. Vallabhapurapu, S., Matsuzawa, A., Zhang, W., Tseng, P. H., Keats, J. J., Wang, H., Vignali, D. A., Bergsagel, P. L., and Karin, M. (2008) Nonredundant and Complementary Functions of TRAF2 and TRAF3 in a Ubiquitination Cascade that Activates NIK-Dependent Alternative NF-kappaB Signaling. Nat. Immunol.. 9, 1364-1370.

  96. Zarnegar, B. J., Wang, Y., Mahoney, D. J., Dempsey, P. W., Cheung, H. H., He, J., Shiba, T., Yang, X., Yeh, W. C., Mak, T. W., Korneluk, R. G., and Cheng, G. (2008) Noncanonical NF-kappaB Activation Requires Coordinated Assembly of a Regulatory Complex of the Adaptors cIAP1, cIAP2, TRAF2 and TRAF3 and the Kinase NIK. Nat. Immunol.. 9, 1371-1378.

  97. Moore, C. R., and Bishop, G. A. (2005) Differential Regulation of CD40-Mediated TNF Receptor-Associated Factor Degradation in B Lymphocytes. J. Immunol.. 175, 3780-3789.

  98. Brown, K. D., Hostager, B. S., and Bishop, G. A. (2002) Regulation of TRAF2 Signaling by Self-Induced Degradation. J. Biol. Chem.. 277, 19433-19438.

  99. Liao, G., Zhang, M., Harhaj, E. W., and Sun, S. C. (2004) Regulation of the NF-kappaB-Inducing Kinase by Tumor Necrosis Factor Receptor-Associated Factor 3-Induced Degradation. J. Biol. Chem.. 279, 26243-26250.

  100. Xiao, G., Harhaj, E. W., and Sun, S. C. (2001) NF-kappaB-Inducing Kinase Regulates the Processing of NF-kappaB2 p100. Mol. Cell. 7, 401-409.

  101. Qing, G., and Xiao, G. (2005) Essential Role of IkappaB Kinase Alpha in the Constitutive Processing of NF-kappaB2 p100. J. Biol. Chem.. 280, 9765-9768.

  102. Xiao, G., Fong, A., and Sun, S. C. (2004) Induction of p100 Processing by NF-kappaB-Inducing Kinase Involves Docking IkappaB Kinase Alpha (IKKalpha) to p100 and IKKalpha-Mediated Phosphorylation. J. Biol. Chem.. 279, 30099-30105.

  103. Dejardin, E., Droin, N. M., Delhase, M., Haas, E., Cao, Y., Makris, C., Li, Z. W., Karin, M., Ware, C. F., and Green, D. R. (2002) The Lymphotoxin-Beta Receptor Induces Different Patterns of Gene Expression Via Two NF-kappaB Pathways. Immunity. 17, 525-535.

  104. Snapper, C. M., Zelazowski, P., Rosas, F. R., Kehry, M. R., Tian, M., Baltimore, D., and Sha, W. C. (1996) B Cells from p50/NF-Kappa B Knockout Mice have Selective Defects in Proliferation, Differentiation, Germ-Line CH Transcription, and Ig Class Switching. J. Immunol.. 156, 183-191.

  105. Pasparakis, M., Schmidt-Supprian, M., and Rajewsky, K. (2002) IkappaB Kinase Signaling is Essential for Maintenance of Mature B Cells. J. Exp. Med.. 196, 743-752.

  106. Kaisho, T., Takeda, K., Tsujimura, T., Kawai, T., Nomura, F., Terada, N., and Akira, S. (2001) IkappaB Kinase Alpha is Essential for Mature B Cell Development and Function. J. Exp. Med.. 193, 417-426.

  107. Yamada, T., Mitani, T., Yorita, K., Uchida, D., Matsushima, A., Iwamasa, K., Fujita, S., and Matsumoto, M. (2000) Abnormal Immune Function of Hemopoietic Cells from Alymphoplasia (Aly) Mice, a Natural Strain with Mutant NF-Kappa B-Inducing Kinase. J. Immunol.. 165, 804-812.

  108. Jain, A., Ma, C. A., Liu, S., Brown, M., Cohen, J., and Strober, W. (2001) Specific Missense Mutations in NEMO Result in Hyper-IgM Syndrome with Hypohydrotic Ectodermal Dysplasia. Nat. Immunol.. 2, 223-228.

  109. Jain, A., Ma, C. A., Lopez-Granados, E., Means, G., Brady, W., Orange, J. S., Liu, S., Holland, S., and Derry, J. M. (2004) Specific NEMO Mutations Impair CD40-Mediated c-Rel Activation and B Cell Terminal Differentiation 3. J. Clin. Invest.. 114, 1593-1602.

  110. Elgueta, R., Benson, M. J., de Vries, V. C., Wasiuk, A., Guo, Y., and Noelle, R. J. (2009) Molecular Mechanism and Function of CD40/CD40L Engagement in the Immune System. Immunol. Rev.. 229, 152-172.

  111. Hanissian, S. H., and Geha, R. S. (1997) Jak3 is Associated with CD40 and is Critical for CD40 Induction of Gene Expression in B Cells. Immunity. 6, 379-387.

  112. Jabara, H. H., Buckley, R. H., Roberts, J. L., Lefranc, G., Loiselet, J., Khalil, G., and Geha, R. S. (1998) Role of JAK3 in CD40-Mediated Signaling. Blood. 92, 2435-2440.

  113. Saemann, M. D., Diakos, C., Kelemen, P., Kriehuber, E., Zeyda, M., Bohmig, G. A., Horl, W. H., Baumruker, T., and Zlabinger, G. J. (2003) Prevention of CD40-Triggered Dendritic Cell Maturation and Induction of T-Cell Hyporeactivity by Targeting of Janus Kinase 3. Am. J. Transplant.. 3, 1341-1349.

  114. Jabara, H., Laouini, D., Tsitsikov, E., Mizoguchi, E., Bhan, A., Castigli, E., Dedeoglu, F., Pivniouk, V., Brodeur, S., and Geha, R. (2002) The Binding Site for TRAF2 and TRAF3 but Not for TRAF6 is Essential for CD40-Mediated Immunoglobulin Class Switching. Immunity. 17, 265-276.

  115. Yasui, T., Muraoka, M., Takaoka-Shichijo, Y., Ishida, I., Takegahara, N., Uchida, J., Kumanogoh, A., Suematsu, S., Suzuki, M., and Kikutani, H. (2002) Dissection of B Cell Differentiation during Primary Immune Responses in Mice with Altered CD40 Signals. Int. Immunol.. 14, 319-329.

  116. Ahonen, C., Manning, E., Erickson, L. D., O'Connor, B., Lind, E. F., Pullen, S. S., Kehry, M. R., and Noelle, R. J. (2002) The CD40-TRAF6 Axis Controls Affinity Maturation and the Generation of Long-Lived Plasma Cells. Nat. Immunol.. 3, 451-456.

  117. Lu, L. F., Ahonen, C. L., Lind, E. F., Raman, V. S., Cook, W. J., Lin, L. L., and Noelle, R. J. (2007) The in Vivo Function of a Noncanonical TRAF2-Binding Domain in the C-Terminus of CD40 in Driving B-Cell Growth and Differentiation. Blood. 110, 193-200.

  118. Lu, L. F., Cook, W. J., Lin, L. L., and Noelle, R. J. (2003) CD40 Signaling through a Newly Identified Tumor Necrosis Factor Receptor-Associated Factor 2 (TRAF2) Binding Site. J. Biol. Chem.. 278, 45414-45418.