Incidental Mutation 'R1182:Or52e8b'
ID 101648
Institutional Source Beutler Lab
Gene Symbol Or52e8b
Ensembl Gene ENSMUSG00000096773
Gene Name olfactory receptor family 52 subfamily E member 8B
Synonyms MOR32-9P, Olfr675, GA_x6K02T2PBJ9-7653782-7652841
MMRRC Submission 039254-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.504) question?
Stock # R1182 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 104673232-104674173 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104673285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 301 (T301A)
Ref Sequence ENSEMBL: ENSMUSP00000149895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073102] [ENSMUST00000210113] [ENSMUST00000214318] [ENSMUST00000215899]
AlphaFold A0A1B0GSE1
Predicted Effect probably damaging
Transcript: ENSMUST00000073102
AA Change: T297A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072847
Gene: ENSMUSG00000096773
AA Change: T297A

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 5e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.9e-6 PFAM
Pfam:7tm_1 43 293 2.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210113
AA Change: T301A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000214318
AA Change: T301A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215899
AA Change: T301A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 T A 8: 84,656,451 (GRCm39) D256E probably damaging Het
Adnp G A 2: 168,026,716 (GRCm39) A193V possibly damaging Het
Atf7ip2 T C 16: 10,059,699 (GRCm39) L413S possibly damaging Het
Clip1 T C 5: 123,785,928 (GRCm39) N252S probably damaging Het
Cubn A T 2: 13,449,811 (GRCm39) N904K probably damaging Het
Draxin T C 4: 148,192,394 (GRCm39) E306G probably damaging Het
Gabrr1 T A 4: 33,132,680 (GRCm39) F9L probably benign Het
Hyal6 T A 6: 24,743,416 (GRCm39) C371S probably damaging Het
Jag1 T A 2: 136,933,409 (GRCm39) I506F probably benign Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Or8k20 T C 2: 86,106,612 (GRCm39) N73S probably damaging Het
Plekhg6 C G 6: 125,349,455 (GRCm39) E381Q probably damaging Het
Prag1 A G 8: 36,614,413 (GRCm39) I1322V possibly damaging Het
Psmc3 T C 2: 90,886,380 (GRCm39) I179T probably damaging Het
Rasgrp3 A G 17: 75,810,185 (GRCm39) D295G probably benign Het
Sh3tc2 T C 18: 62,101,171 (GRCm39) V88A probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Vmn1r232 C A 17: 21,133,705 (GRCm39) L298F possibly damaging Het
Zfp629 C A 7: 127,209,274 (GRCm39) C845F probably damaging Het
Other mutations in Or52e8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02639:Or52e8b APN 7 104,673,429 (GRCm39) missense probably damaging 1.00
IGL02944:Or52e8b APN 7 104,674,130 (GRCm39) missense probably damaging 1.00
R1412:Or52e8b UTSW 7 104,673,402 (GRCm39) missense probably damaging 1.00
R1528:Or52e8b UTSW 7 104,673,971 (GRCm39) missense probably damaging 1.00
R1555:Or52e8b UTSW 7 104,673,729 (GRCm39) missense probably benign 0.00
R1589:Or52e8b UTSW 7 104,673,767 (GRCm39) missense probably benign
R1778:Or52e8b UTSW 7 104,673,370 (GRCm39) missense probably benign 0.03
R3690:Or52e8b UTSW 7 104,673,902 (GRCm39) missense probably damaging 0.99
R3848:Or52e8b UTSW 7 104,673,539 (GRCm39) missense probably damaging 0.99
R4784:Or52e8b UTSW 7 104,673,737 (GRCm39) missense probably damaging 0.97
R5050:Or52e8b UTSW 7 104,673,594 (GRCm39) missense probably damaging 1.00
R5074:Or52e8b UTSW 7 104,673,260 (GRCm39) missense probably benign
R5499:Or52e8b UTSW 7 104,674,184 (GRCm39) start codon destroyed probably null 0.06
R5586:Or52e8b UTSW 7 104,673,428 (GRCm39) missense probably damaging 1.00
R7244:Or52e8b UTSW 7 104,674,148 (GRCm39) missense probably benign
R8297:Or52e8b UTSW 7 104,673,885 (GRCm39) missense probably benign 0.14
R8532:Or52e8b UTSW 7 104,673,773 (GRCm39) missense probably damaging 1.00
R9087:Or52e8b UTSW 7 104,673,910 (GRCm39) nonsense probably null
Z1176:Or52e8b UTSW 7 104,673,306 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACAGTAAGTTTGTCTCTTTCCCAG -3'
(R):5'- CTTGTGCCAGCATCAAAGTCAACATC -3'

Sequencing Primer
(F):5'- CCCAGTTTTCTATGTACTACACAC -3'
(R):5'- TCAAGGCTCTCAATACTTGTGG -3'
Posted On 2014-01-15