Mutagenetix > Incidental Mutation

Incidental Mutation 'R1185:Sorbs1'

102078

Institutional Source

Beutler Lab

Gene Symbol

Sorbs1

Ensembl Gene

ENSMUSG00000025006

Gene Name

sorbin and SH3 domain containing 1

Synonyms

c-Cbl-associated protein, Ponsin, CAP, 2310065E01Rik, 9530001P15Rik, Sh3d5

MMRRC Submission

039257-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.815) question?

Stock #

R1185 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40283197-40502223 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40371050 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 79 (D79V)

Ref Sequence

ENSEMBL: ENSMUSP00000153080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224233] [ENSMUST00000224667] [ENSMUST00000224247] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047] [ENSMUST00000224583]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000099466
AA Change: D79V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006
AA Change: D79V

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	203	249	1.07e-26	SMART
SH3	502	557	2.72e-18	SMART
SH3	576	633	9.32e-17	SMART
low complexity region	647	660	N/A	INTRINSIC
SH3	682	739	3.7e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000099467
AA Change: D79V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: D79V

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
low complexity region	192	213	N/A	INTRINSIC
Sorb	327	373	1.24e-22	SMART
coiled coil region	558	584	N/A	INTRINSIC
SH3	700	755	2.72e-18	SMART
SH3	774	831	9.32e-17	SMART
low complexity region	845	858	N/A	INTRINSIC
SH3	880	937	3.7e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000165212
AA Change: D79V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006
AA Change: D79V

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	193	239	1.07e-26	SMART
SH3	486	541	2.72e-18	SMART
SH3	560	617	9.32e-17	SMART
low complexity region	631	644	N/A	INTRINSIC
SH3	666	723	3.7e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000165469
AA Change: D109V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006
AA Change: D109V

Domain	Start	End	E-Value	Type
low complexity region	75	93	N/A	INTRINSIC
Sorb	233	279	1.07e-26	SMART
SH3	476	531	2.72e-18	SMART
SH3	550	607	9.32e-17	SMART
low complexity region	621	634	N/A	INTRINSIC
SH3	656	713	3.7e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223724

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224227

Predicted Effect

probably damaging
Transcript: ENSMUST00000224233
AA Change: D79V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000224667
AA Change: D88V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224247
AA Change: D79V

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225148
AA Change: D79V

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225153
AA Change: D79V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225786
AA Change: D109V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226047
AA Change: D79V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225766

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225879

Predicted Effect

probably benign
Transcript: ENSMUST00000224583

Meta Mutation Damage Score

0.1254

Coding Region Coverage

1x: 98.2%
3x: 96.3%
10x: 87.8%
20x: 68.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aimp2	A	G	5: 143,841,509 (GRCm39)	S110P	possibly damaging	Het
Akap9	A	G	5: 3,998,783 (GRCm39)	T51A	probably benign	Het
Arhgef25	A	G	10: 127,019,650 (GRCm39)	F430L	possibly damaging	Het
Brap	T	C	5: 121,813,342 (GRCm39)	V235A	probably damaging	Het
Cd69	C	T	6: 129,247,148 (GRCm39)	G23D	probably damaging	Het
Cecr2	C	T	6: 120,735,166 (GRCm39)	R24*	probably null	Het
Celsr2	T	C	3: 108,307,025 (GRCm39)	D1974G	possibly damaging	Het
Cps1	A	G	1: 67,234,358 (GRCm39)	K915R	probably benign	Het
Csmd1	T	C	8: 16,408,362 (GRCm39)	D401G	probably damaging	Het
Dusp13b	A	G	14: 21,785,086 (GRCm39)	F141S	probably damaging	Het
Eif1ad19	A	G	12: 87,740,478 (GRCm39)	V27A	probably benign	Het
Fam162b	A	G	10: 51,466,439 (GRCm39)	W27R	probably benign	Het
Focad	A	G	4: 88,096,424 (GRCm39)	T269A	probably benign	Het
Ghr	T	A	15: 3,357,544 (GRCm39)	R241S	possibly damaging	Het
Hirip3	AAGAG	AAG	7: 126,462,832 (GRCm39)		probably null	Het
Ift70a1	A	T	2: 75,810,696 (GRCm39)	N462K	probably damaging	Het
Itgb2l	A	G	16: 96,230,240 (GRCm39)	Y357H	possibly damaging	Het
Jrkl	T	C	9: 13,244,938 (GRCm39)	D241G	possibly damaging	Het
Lmod1	A	G	1: 135,291,967 (GRCm39)	D274G	probably benign	Het
Lrrn2	A	G	1: 132,866,959 (GRCm39)	S675G	probably benign	Het
Ltbp4	G	C	7: 27,009,960 (GRCm39)	P1200R	probably damaging	Het
Mdn1	T	C	4: 32,735,576 (GRCm39)	L3414P	possibly damaging	Het
Myo16	T	A	8: 10,683,624 (GRCm39)	S1856T	probably damaging	Het
Neb	A	G	2: 52,186,310 (GRCm39)	Y921H	probably damaging	Het
Or2n1c	T	A	17: 38,520,074 (GRCm39)	*313R	probably null	Het
Pgap3	T	C	11: 98,281,960 (GRCm39)	D117G	probably damaging	Het
Ppp1r9b	T	C	11: 94,892,812 (GRCm39)	F671L	possibly damaging	Het
Proser3	G	A	7: 30,245,572 (GRCm39)	A144V	probably benign	Het
Purg	T	G	8: 33,876,897 (GRCm39)	Y178*	probably null	Het
Sfi1	TCGC	TC	11: 3,096,254 (GRCm39)		probably null	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,127,419 (GRCm39)		probably benign	Het
Tcaf3	T	C	6: 42,568,368 (GRCm39)	T663A	probably damaging	Het
Timd4	C	A	11: 46,708,475 (GRCm39)	T167K	probably damaging	Het
Tjp2	A	G	19: 24,108,527 (GRCm39)	L195P	possibly damaging	Het
Tnr	G	A	1: 159,679,856 (GRCm39)	A277T	probably benign	Het
Unc13a	C	T	8: 72,114,477 (GRCm39)	G181D	probably benign	Het
Vmn1r11	T	A	6: 57,114,492 (GRCm39)	L52Q	possibly damaging	Het
Vmn2r125	C	A	4: 156,703,396 (GRCm39)	A258D	probably benign	Het
Zfp27	T	C	7: 29,595,254 (GRCm39)	D237G	possibly damaging	Het
Zfp39	T	C	11: 58,793,670 (GRCm39)	T23A	possibly damaging	Het
Zfp459	T	G	13: 67,556,600 (GRCm39)	N161T	probably benign	Het

Other mutations in Sorbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Sorbs1	APN	19	40,306,473 (GRCm39)	missense	probably damaging	1.00
IGL00776:Sorbs1	APN	19	40,332,795 (GRCm39)	splice site	probably null
IGL00788:Sorbs1	APN	19	40,325,487 (GRCm39)	splice site	probably benign
IGL00943:Sorbs1	APN	19	40,283,484 (GRCm39)	utr 3 prime	probably benign
IGL01525:Sorbs1	APN	19	40,338,422 (GRCm39)	missense	probably damaging	1.00
IGL01530:Sorbs1	APN	19	40,365,091 (GRCm39)	missense	probably benign	0.01
IGL01951:Sorbs1	APN	19	40,306,460 (GRCm39)	splice site	probably benign
IGL02159:Sorbs1	APN	19	40,316,040 (GRCm39)	missense	probably damaging	0.96
IGL02252:Sorbs1	APN	19	40,302,841 (GRCm39)	missense	probably damaging	1.00
IGL02613:Sorbs1	APN	19	40,315,991 (GRCm39)	missense	probably damaging	1.00
IGL02643:Sorbs1	APN	19	40,353,577 (GRCm39)	missense	possibly damaging	0.65
IGL02668:Sorbs1	APN	19	40,303,125 (GRCm39)	missense	probably damaging	1.00
IGL02738:Sorbs1	APN	19	40,365,348 (GRCm39)	missense	probably damaging	0.97
IGL02965:Sorbs1	APN	19	40,365,187 (GRCm39)	missense	probably benign	0.01
IGL03083:Sorbs1	APN	19	40,302,820 (GRCm39)	missense	probably damaging	1.00
IGL03173:Sorbs1	APN	19	40,351,706 (GRCm39)	missense	probably damaging	1.00
IGL03286:Sorbs1	APN	19	40,332,858 (GRCm39)	missense	probably damaging	0.99
IGL03292:Sorbs1	APN	19	40,362,009 (GRCm39)	missense	possibly damaging	0.79
R0016:Sorbs1	UTSW	19	40,303,182 (GRCm39)	splice site	probably benign
R0016:Sorbs1	UTSW	19	40,303,182 (GRCm39)	splice site	probably benign
R0306:Sorbs1	UTSW	19	40,332,855 (GRCm39)	missense	possibly damaging	0.94
R0526:Sorbs1	UTSW	19	40,338,392 (GRCm39)	missense	probably damaging	1.00
R0551:Sorbs1	UTSW	19	40,300,260 (GRCm39)	missense	probably damaging	1.00
R0688:Sorbs1	UTSW	19	40,351,706 (GRCm39)	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40,371,050 (GRCm39)	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40,371,050 (GRCm39)	missense	probably damaging	1.00
R1891:Sorbs1	UTSW	19	40,381,904 (GRCm39)	missense	probably damaging	0.99
R2066:Sorbs1	UTSW	19	40,353,472 (GRCm39)	splice site	probably null
R2148:Sorbs1	UTSW	19	40,365,268 (GRCm39)	missense	possibly damaging	0.94
R2214:Sorbs1	UTSW	19	40,285,075 (GRCm39)	missense	probably damaging	1.00
R2410:Sorbs1	UTSW	19	40,361,959 (GRCm39)	missense	probably damaging	0.99
R2940:Sorbs1	UTSW	19	40,362,015 (GRCm39)	missense	probably damaging	1.00
R3847:Sorbs1	UTSW	19	40,302,887 (GRCm39)	missense	probably damaging	0.97
R4405:Sorbs1	UTSW	19	40,384,189 (GRCm39)	missense	probably benign	0.03
R4544:Sorbs1	UTSW	19	40,300,294 (GRCm39)	missense	probably damaging	0.99
R4618:Sorbs1	UTSW	19	40,361,962 (GRCm39)	missense	probably damaging	0.99
R4731:Sorbs1	UTSW	19	40,303,133 (GRCm39)	missense	probably benign	0.29
R4732:Sorbs1	UTSW	19	40,303,133 (GRCm39)	missense	probably benign	0.29
R4733:Sorbs1	UTSW	19	40,303,133 (GRCm39)	missense	probably benign	0.29
R4860:Sorbs1	UTSW	19	40,325,449 (GRCm39)	missense	probably benign	0.44
R4860:Sorbs1	UTSW	19	40,325,449 (GRCm39)	missense	probably benign	0.44
R4907:Sorbs1	UTSW	19	40,328,491 (GRCm39)	nonsense	probably null
R4912:Sorbs1	UTSW	19	40,300,171 (GRCm39)	missense	probably damaging	1.00
R5229:Sorbs1	UTSW	19	40,329,151 (GRCm39)	missense	probably damaging	1.00
R5285:Sorbs1	UTSW	19	40,310,334 (GRCm39)	missense	probably damaging	1.00
R5416:Sorbs1	UTSW	19	40,365,433 (GRCm39)	missense	probably benign	0.06
R5706:Sorbs1	UTSW	19	40,365,325 (GRCm39)	missense	probably benign
R5871:Sorbs1	UTSW	19	40,387,027 (GRCm39)	missense	probably damaging	1.00
R5936:Sorbs1	UTSW	19	40,313,216 (GRCm39)	missense	probably damaging	0.96
R6073:Sorbs1	UTSW	19	40,303,101 (GRCm39)	missense	probably damaging	1.00
R6324:Sorbs1	UTSW	19	40,310,263 (GRCm39)	missense	probably damaging	0.99
R6343:Sorbs1	UTSW	19	40,365,426 (GRCm39)	critical splice donor site	probably null
R6561:Sorbs1	UTSW	19	40,314,496 (GRCm39)	missense	probably benign
R6646:Sorbs1	UTSW	19	40,313,993 (GRCm39)	missense	probably damaging	1.00
R6768:Sorbs1	UTSW	19	40,315,991 (GRCm39)	missense	probably damaging	1.00
R6849:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R6850:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R6878:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R6879:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R6880:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R6908:Sorbs1	UTSW	19	40,340,776 (GRCm39)	missense	probably damaging	1.00
R6980:Sorbs1	UTSW	19	40,316,060 (GRCm39)	nonsense	probably null
R7040:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7041:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7110:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7122:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7170:Sorbs1	UTSW	19	40,314,573 (GRCm39)	nonsense	probably null
R7180:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7185:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7187:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7254:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7255:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7401:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7595:Sorbs1	UTSW	19	40,303,097 (GRCm39)	missense	probably damaging	0.99
R7819:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R7876:Sorbs1	UTSW	19	40,285,032 (GRCm39)	missense	probably damaging	1.00
R7894:Sorbs1	UTSW	19	40,316,020 (GRCm39)	missense	probably benign	0.02
R7986:Sorbs1	UTSW	19	40,353,449 (GRCm39)	missense	probably damaging	0.99
R8031:Sorbs1	UTSW	19	40,314,933 (GRCm39)	missense	probably benign	0.17
R8082:Sorbs1	UTSW	19	40,353,527 (GRCm39)	missense	probably benign	0.08
R8282:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8283:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8446:Sorbs1	UTSW	19	40,314,602 (GRCm39)	missense	probably benign
R8526:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8527:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8528:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8539:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8540:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8542:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8543:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8544:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8545:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8684:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8699:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8702:Sorbs1	UTSW	19	40,365,244 (GRCm39)	missense	probably benign
R8752:Sorbs1	UTSW	19	40,349,872 (GRCm39)	critical splice donor site	probably null
R8937:Sorbs1	UTSW	19	40,362,006 (GRCm39)	missense	probably benign	0.02
R8956:Sorbs1	UTSW	19	40,351,660 (GRCm39)	missense	probably damaging	1.00
R8960:Sorbs1	UTSW	19	40,387,048 (GRCm39)	missense	probably damaging	0.98
R9175:Sorbs1	UTSW	19	40,315,018 (GRCm39)	missense	probably damaging	1.00
R9208:Sorbs1	UTSW	19	40,353,462 (GRCm39)	start gained	probably benign
R9211:Sorbs1	UTSW	19	40,332,798 (GRCm39)	critical splice donor site	probably null
R9371:Sorbs1	UTSW	19	40,315,324 (GRCm39)	missense	probably damaging	0.98
R9374:Sorbs1	UTSW	19	40,361,923 (GRCm39)	nonsense	probably null
R9377:Sorbs1	UTSW	19	40,387,048 (GRCm39)	missense	probably damaging	0.98
R9551:Sorbs1	UTSW	19	40,361,923 (GRCm39)	nonsense	probably null
R9552:Sorbs1	UTSW	19	40,361,923 (GRCm39)	nonsense	probably null
R9686:Sorbs1	UTSW	19	40,381,954 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorbs1	UTSW	19	40,315,339 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CGGACTGTGAATCCAGCCTGTG -3'
(R):5'- CCAGAGGACCCTTCAGCAGGTATG -3'

Sequencing Primer
(F):5'- GCTATTCCAGAGACGATCAGAGTC -3'
(R):5'- CTTCAGCAGGTATGGCTTTTC -3'

Posted On

2014-01-15