Incidental Mutation 'R1336:Chsy1'
ID156872
Institutional Source Beutler Lab
Gene Symbol Chsy1
Ensembl Gene ENSMUSG00000032640
Gene Namechondroitin sulfate synthase 1
Synonyms
MMRRC Submission 039401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1336 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location66109515-66173798 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 66125239 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036372]
Predicted Effect probably null
Transcript: ENSMUST00000036372
SMART Domains Protein: ENSMUSP00000047487
Gene: ENSMUSG00000032640

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Fringe 81 307 3.8e-21 PFAM
Pfam:CHGN 237 776 9.8e-197 PFAM
Pfam:Glyco_tranf_2_2 548 751 1.2e-10 PFAM
Pfam:Glyco_transf_7C 674 747 2.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205601
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. These enzymes possess dual glucuronyltransferase and galactosaminyltransferase activity and play critical roles in the biosynthesis of chondroitin sulfate, a glycosaminoglycan involved in many biological processes including cell proliferation and morphogenesis. Decreased expression of this gene may play a role in colorectal cancer, and mutations in this gene are a cause of temtamy preaxial brachydactyly syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mice are viable, but display chondrodysplasia, brachydactyly and decreased bone density. Retinal degeneration, impaired motor strength, and hematological abnormalities are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Bbs7 A G 3: 36,604,444 I227T probably benign Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Fcrl6 G A 1: 172,599,224 Q52* probably null Het
Fgl2 T A 5: 21,373,183 L156Q possibly damaging Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Papss2 T C 19: 32,638,315 V149A possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Ros1 G A 10: 52,168,662 T183I probably damaging Het
Snx4 T C 16: 33,280,680 I234T probably benign Het
Sptbn4 A G 7: 27,417,963 S454P probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Other mutations in Chsy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Chsy1 APN 7 66172126 missense possibly damaging 0.70
IGL01734:Chsy1 APN 7 66171310 missense probably damaging 0.98
IGL02037:Chsy1 APN 7 66171828 missense possibly damaging 0.69
IGL02797:Chsy1 APN 7 66171664 missense probably damaging 1.00
IGL02961:Chsy1 APN 7 66171782 missense probably benign 0.00
IGL03290:Chsy1 APN 7 66171031 missense probably benign 0.15
IGL03292:Chsy1 APN 7 66125372 missense probably benign 0.02
deprimido UTSW 7 66171687 missense probably damaging 1.00
Elevado UTSW 7 66110076 nonsense probably null
R0669:Chsy1 UTSW 7 66171687 missense probably damaging 1.00
R1499:Chsy1 UTSW 7 66172002 missense probably damaging 1.00
R1640:Chsy1 UTSW 7 66171514 missense probably benign 0.34
R1674:Chsy1 UTSW 7 66171663 missense probably damaging 1.00
R1812:Chsy1 UTSW 7 66171817 missense probably benign 0.12
R1934:Chsy1 UTSW 7 66172243 missense probably damaging 1.00
R2964:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2965:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2966:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R3692:Chsy1 UTSW 7 66171253 missense probably damaging 1.00
R4890:Chsy1 UTSW 7 66110226 missense probably benign 0.00
R5373:Chsy1 UTSW 7 66110076 nonsense probably null
R5936:Chsy1 UTSW 7 66172277 missense possibly damaging 0.89
R6149:Chsy1 UTSW 7 66125385 missense probably damaging 1.00
R6192:Chsy1 UTSW 7 66170877 missense probably benign 0.29
R6653:Chsy1 UTSW 7 66110193 missense probably benign 0.10
R6848:Chsy1 UTSW 7 66171037 missense probably damaging 1.00
R7318:Chsy1 UTSW 7 66110229 critical splice donor site probably null
R7514:Chsy1 UTSW 7 66172120 missense not run
R7560:Chsy1 UTSW 7 66171244 missense not run
R7560:Chsy1 UTSW 7 66171571 missense not run
X0012:Chsy1 UTSW 7 66172168 missense probably damaging 1.00
X0063:Chsy1 UTSW 7 66171924 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCGCAAGAGGAACTTTGCAAC -3'
(R):5'- GTCATCGTCTGCCCTCATAAACCAC -3'

Sequencing Primer
(F):5'- gtcagttctcgctttcaacc -3'
(R):5'- CACTCGTACTTGTCCAGGTAG -3'
Posted On2014-02-11