Incidental Mutation 'R1429:Rassf8'
ID161437
Institutional Source Beutler Lab
Gene Symbol Rassf8
Ensembl Gene ENSMUSG00000030259
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms5133400D11Rik, mHoj-1
MMRRC Submission 039485-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R1429 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location145746748-145821079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 145815190 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 81 (G81W)
Ref Sequence ENSEMBL: ENSMUSP00000107333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]
Predicted Effect probably damaging
Transcript: ENSMUST00000032388
AA Change: G81W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: G81W

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058538
Predicted Effect probably damaging
Transcript: ENSMUST00000111704
AA Change: G81W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: G81W

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140966
SMART Domains Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 80 7.85e-7 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Alg8 C T 7: 97,390,292 A410V probably benign Het
Arhgef4 A G 1: 34,810,339 Y481C probably damaging Het
Armc8 A G 9: 99,536,207 V56A possibly damaging Het
Cactin T C 10: 81,323,678 I23T probably damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cfap54 T C 10: 92,821,038 I3051V probably benign Het
Cpxm1 A T 2: 130,396,444 I66N probably damaging Het
Ddx50 G A 10: 62,647,068 T74I possibly damaging Het
Dgcr14 G A 16: 17,902,205 R427* probably null Het
Dnah7b G T 1: 46,289,656 D3183Y possibly damaging Het
Dsg1b A G 18: 20,390,195 D93G probably damaging Het
Fam135a T G 1: 24,044,267 K292N probably damaging Het
Fam83b G T 9: 76,492,577 R415S probably benign Het
Fxyd3 T A 7: 31,073,621 M1L probably benign Het
Gm5134 T A 10: 75,978,381 M193K probably damaging Het
Golgb1 A G 16: 36,900,563 E427G possibly damaging Het
Gpat3 G A 5: 100,893,087 G338S probably damaging Het
Hmgxb3 C T 18: 61,150,433 R606Q probably damaging Het
Itgb1 T C 8: 128,717,676 probably null Het
Myh1 C A 11: 67,217,910 T1384K possibly damaging Het
Myo3b A C 2: 70,253,007 Q640P probably damaging Het
Naa16 A G 14: 79,359,527 V305A probably benign Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Pgap1 T C 1: 54,494,861 D631G probably benign Het
Phc2 C A 4: 128,743,555 P51Q probably damaging Het
Pmel G A 10: 128,718,992 probably null Het
Rfx2 G T 17: 56,804,369 Q68K probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsbn1l A G 5: 20,920,018 L262S probably damaging Het
S100a16 A C 3: 90,542,084 Y22S probably damaging Het
Stx19 G A 16: 62,822,597 V259I possibly damaging Het
Tas2r105 T C 6: 131,686,941 I175V probably benign Het
Vmn2r67 T A 7: 85,152,823 H90L possibly damaging Het
Wscd1 T A 11: 71,760,174 L109Q probably damaging Het
Zfp423 T A 8: 87,686,442 Q1154L probably damaging Het
Zmym6 T C 4: 127,123,879 L1059P probably damaging Het
Other mutations in Rassf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02973:Rassf8 APN 6 145817190 unclassified probably benign
IGL03017:Rassf8 APN 6 145817198 unclassified probably null
IGL03091:Rassf8 APN 6 145815810 missense probably benign 0.00
R0230:Rassf8 UTSW 6 145819974 unclassified probably benign
R0967:Rassf8 UTSW 6 145819950 unclassified probably benign
R1622:Rassf8 UTSW 6 145820103 unclassified probably benign
R1738:Rassf8 UTSW 6 145815308 missense probably benign 0.03
R1894:Rassf8 UTSW 6 145808473 missense probably damaging 1.00
R2126:Rassf8 UTSW 6 145815182 missense probably benign 0.00
R2238:Rassf8 UTSW 6 145817184 missense probably damaging 1.00
R2439:Rassf8 UTSW 6 145815334 missense probably damaging 1.00
R3699:Rassf8 UTSW 6 145820076 unclassified probably benign
R4678:Rassf8 UTSW 6 145815082 missense probably damaging 1.00
R4734:Rassf8 UTSW 6 145815540 missense probably benign 0.34
R4826:Rassf8 UTSW 6 145816550 missense probably damaging 1.00
R4910:Rassf8 UTSW 6 145815280 nonsense probably null
R4988:Rassf8 UTSW 6 145817144 missense possibly damaging 0.89
R5425:Rassf8 UTSW 6 145815542 missense probably benign
R5620:Rassf8 UTSW 6 145820181 unclassified probably benign
R5747:Rassf8 UTSW 6 145815815 missense probably benign 0.00
R6136:Rassf8 UTSW 6 145815656 missense probably benign 0.00
R6220:Rassf8 UTSW 6 145817133 missense probably damaging 1.00
R7274:Rassf8 UTSW 6 145815569 missense probably benign 0.03
R7315:Rassf8 UTSW 6 145815751 missense probably benign
Z1088:Rassf8 UTSW 6 145815482 missense probably benign
Z1088:Rassf8 UTSW 6 145816616 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGTCCTCCGCTGCATTACTGATGG -3'
(R):5'- AGCACCTTCTGCCTGAACTCAGTC -3'

Sequencing Primer
(F):5'- ACTGATGGTTGCATGTCCC -3'
(R):5'- AAAAATGTCCGTCAGCCCTTTG -3'
Posted On2014-03-14